ID: 1120055675

View in Genome Browser
Species Human (GRCh38)
Location 14:79921245-79921267
Sequence TTATAGCATTGATTATCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120055675_1120055680 6 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055680 14:79921274-79921296 ATAGTGCACTTTAATGGGTAGGG No data
1120055675_1120055681 10 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055681 14:79921278-79921300 TGCACTTTAATGGGTAGGGAAGG No data
1120055675_1120055678 1 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055678 14:79921269-79921291 GAAAAATAGTGCACTTTAATGGG No data
1120055675_1120055683 22 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055683 14:79921290-79921312 GGTAGGGAAGGGCAGAAGAGAGG No data
1120055675_1120055682 11 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055682 14:79921279-79921301 GCACTTTAATGGGTAGGGAAGGG No data
1120055675_1120055677 0 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055677 14:79921268-79921290 GGAAAAATAGTGCACTTTAATGG No data
1120055675_1120055679 5 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055679 14:79921273-79921295 AATAGTGCACTTTAATGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120055675 Original CRISPR TTATAGCATTGATTATCACT TGG (reversed) Intergenic
No off target data available for this crispr