ID: 1120055680

View in Genome Browser
Species Human (GRCh38)
Location 14:79921274-79921296
Sequence ATAGTGCACTTTAATGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120055675_1120055680 6 Left 1120055675 14:79921245-79921267 CCAAGTGATAATCAATGCTATAA No data
Right 1120055680 14:79921274-79921296 ATAGTGCACTTTAATGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120055680 Original CRISPR ATAGTGCACTTTAATGGGTA GGG Intergenic
No off target data available for this crispr