ID: 1120056737

View in Genome Browser
Species Human (GRCh38)
Location 14:79933043-79933065
Sequence CTCCATGGTAGCAAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120056737_1120056742 26 Left 1120056737 14:79933043-79933065 CCTGGGTCCTTGCTACCATGGAG No data
Right 1120056742 14:79933092-79933114 TTTGAAACTTTTTGAATATGAGG No data
1120056737_1120056743 27 Left 1120056737 14:79933043-79933065 CCTGGGTCCTTGCTACCATGGAG No data
Right 1120056743 14:79933093-79933115 TTGAAACTTTTTGAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120056737 Original CRISPR CTCCATGGTAGCAAGGACCC AGG (reversed) Intergenic
No off target data available for this crispr