ID: 1120058660

View in Genome Browser
Species Human (GRCh38)
Location 14:79955484-79955506
Sequence CAACATTTGCTTGTCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8092
Summary {0: 17, 1: 411, 2: 3935, 3: 2481, 4: 1248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120058660_1120058663 -2 Left 1120058660 14:79955484-79955506 CCTTTTCAGACAAGCAAATGTTG 0: 17
1: 411
2: 3935
3: 2481
4: 1248
Right 1120058663 14:79955505-79955527 TGGGATAATTCCCCACCATCAGG No data
1120058660_1120058669 23 Left 1120058660 14:79955484-79955506 CCTTTTCAGACAAGCAAATGTTG 0: 17
1: 411
2: 3935
3: 2481
4: 1248
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data
1120058660_1120058668 22 Left 1120058660 14:79955484-79955506 CCTTTTCAGACAAGCAAATGTTG 0: 17
1: 411
2: 3935
3: 2481
4: 1248
Right 1120058668 14:79955529-79955551 CTGCCTTGCAAAACTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120058660 Original CRISPR CAACATTTGCTTGTCTGAAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr