ID: 1120058665

View in Genome Browser
Species Human (GRCh38)
Location 14:79955516-79955538
Sequence TGCAAGGCAGTCCTGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120058665_1120058669 -9 Left 1120058665 14:79955516-79955538 CCCACCATCAGGACTGCCTTGCA No data
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data
1120058665_1120058673 10 Left 1120058665 14:79955516-79955538 CCCACCATCAGGACTGCCTTGCA No data
Right 1120058673 14:79955549-79955571 AGGGAGTACTAAATATGGAAAGG No data
1120058665_1120058668 -10 Left 1120058665 14:79955516-79955538 CCCACCATCAGGACTGCCTTGCA No data
Right 1120058668 14:79955529-79955551 CTGCCTTGCAAAACTCCTGAAGG No data
1120058665_1120058672 5 Left 1120058665 14:79955516-79955538 CCCACCATCAGGACTGCCTTGCA No data
Right 1120058672 14:79955544-79955566 CCTGAAGGGAGTACTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120058665 Original CRISPR TGCAAGGCAGTCCTGATGGT GGG (reversed) Intergenic
No off target data available for this crispr