ID: 1120058666

View in Genome Browser
Species Human (GRCh38)
Location 14:79955517-79955539
Sequence TTGCAAGGCAGTCCTGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120058666_1120058669 -10 Left 1120058666 14:79955517-79955539 CCACCATCAGGACTGCCTTGCAA No data
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data
1120058666_1120058673 9 Left 1120058666 14:79955517-79955539 CCACCATCAGGACTGCCTTGCAA No data
Right 1120058673 14:79955549-79955571 AGGGAGTACTAAATATGGAAAGG No data
1120058666_1120058672 4 Left 1120058666 14:79955517-79955539 CCACCATCAGGACTGCCTTGCAA No data
Right 1120058672 14:79955544-79955566 CCTGAAGGGAGTACTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120058666 Original CRISPR TTGCAAGGCAGTCCTGATGG TGG (reversed) Intergenic
No off target data available for this crispr