ID: 1120058669

View in Genome Browser
Species Human (GRCh38)
Location 14:79955530-79955552
Sequence TGCCTTGCAAAACTCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120058665_1120058669 -9 Left 1120058665 14:79955516-79955538 CCCACCATCAGGACTGCCTTGCA No data
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data
1120058660_1120058669 23 Left 1120058660 14:79955484-79955506 CCTTTTCAGACAAGCAAATGTTG 0: 17
1: 411
2: 3935
3: 2481
4: 1248
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data
1120058666_1120058669 -10 Left 1120058666 14:79955517-79955539 CCACCATCAGGACTGCCTTGCAA No data
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data
1120058664_1120058669 -8 Left 1120058664 14:79955515-79955537 CCCCACCATCAGGACTGCCTTGC No data
Right 1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120058669 Original CRISPR TGCCTTGCAAAACTCCTGAA GGG Intergenic
No off target data available for this crispr