ID: 1120061649

View in Genome Browser
Species Human (GRCh38)
Location 14:79990399-79990421
Sequence TCTTCCTTCTCCCACACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120061649_1120061653 -1 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061653 14:79990421-79990443 ATGATGTTATAGGTTGGAGGAGG No data
1120061649_1120061654 5 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061654 14:79990427-79990449 TTATAGGTTGGAGGAGGACATGG No data
1120061649_1120061655 22 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061655 14:79990444-79990466 ACATGGAAGAAAGAAAAAGATGG No data
1120061649_1120061651 -7 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061651 14:79990415-79990437 AGGAAGATGATGTTATAGGTTGG No data
1120061649_1120061652 -4 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061652 14:79990418-79990440 AAGATGATGTTATAGGTTGGAGG No data
1120061649_1120061656 30 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061656 14:79990452-79990474 GAAAGAAAAAGATGGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120061649 Original CRISPR TCTTCCTTCTCCCACACAAA AGG (reversed) Intergenic
No off target data available for this crispr