ID: 1120061653

View in Genome Browser
Species Human (GRCh38)
Location 14:79990421-79990443
Sequence ATGATGTTATAGGTTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120061649_1120061653 -1 Left 1120061649 14:79990399-79990421 CCTTTTGTGTGGGAGAAGGAAGA No data
Right 1120061653 14:79990421-79990443 ATGATGTTATAGGTTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120061653 Original CRISPR ATGATGTTATAGGTTGGAGG AGG Intergenic
No off target data available for this crispr