ID: 1120064182

View in Genome Browser
Species Human (GRCh38)
Location 14:80020342-80020364
Sequence CAGGCTCAGGATTAGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120064182_1120064189 3 Left 1120064182 14:80020342-80020364 CCCAATCCCTAATCCTGAGCCTG No data
Right 1120064189 14:80020368-80020390 TCTGTTAGGTGCTTTTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120064182 Original CRISPR CAGGCTCAGGATTAGGGATT GGG (reversed) Intergenic
No off target data available for this crispr