ID: 1120064669

View in Genome Browser
Species Human (GRCh38)
Location 14:80027146-80027168
Sequence AAATATGCACAAATAGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120064666_1120064669 8 Left 1120064666 14:80027115-80027137 CCACTAGGCAAGGTTCTGGAGCA No data
Right 1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG No data
1120064661_1120064669 20 Left 1120064661 14:80027103-80027125 CCTTGTCCTCCTCCACTAGGCAA No data
Right 1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG No data
1120064665_1120064669 11 Left 1120064665 14:80027112-80027134 CCTCCACTAGGCAAGGTTCTGGA No data
Right 1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG No data
1120064663_1120064669 14 Left 1120064663 14:80027109-80027131 CCTCCTCCACTAGGCAAGGTTCT No data
Right 1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120064669 Original CRISPR AAATATGCACAAATAGACCA AGG Intergenic
No off target data available for this crispr