ID: 1120067168

View in Genome Browser
Species Human (GRCh38)
Location 14:80056239-80056261
Sequence CACACACACCCCAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120067168_1120067173 12 Left 1120067168 14:80056239-80056261 CCCCCAGGCCTGGGGTGTGTGTG No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120067168 Original CRISPR CACACACACCCCAGGCCTGG GGG (reversed) Intergenic