ID: 1120067173

View in Genome Browser
Species Human (GRCh38)
Location 14:80056274-80056296
Sequence CTCCTTTGCAACTCAGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120067166_1120067173 18 Left 1120067166 14:80056233-80056255 CCTCCACCCCCAGGCCTGGGGTG No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data
1120067172_1120067173 4 Left 1120067172 14:80056247-80056269 CCTGGGGTGTGTGTGTGTGTGTG No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data
1120067171_1120067173 9 Left 1120067171 14:80056242-80056264 CCAGGCCTGGGGTGTGTGTGTGT No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data
1120067168_1120067173 12 Left 1120067168 14:80056239-80056261 CCCCCAGGCCTGGGGTGTGTGTG 0: 1
1: 0
2: 10
3: 95
4: 559
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data
1120067169_1120067173 11 Left 1120067169 14:80056240-80056262 CCCCAGGCCTGGGGTGTGTGTGT No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data
1120067170_1120067173 10 Left 1120067170 14:80056241-80056263 CCCAGGCCTGGGGTGTGTGTGTG No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data
1120067167_1120067173 15 Left 1120067167 14:80056236-80056258 CCACCCCCAGGCCTGGGGTGTGT No data
Right 1120067173 14:80056274-80056296 CTCCTTTGCAACTCAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120067173 Original CRISPR CTCCTTTGCAACTCAGCTCT AGG Intergenic