ID: 1120070561

View in Genome Browser
Species Human (GRCh38)
Location 14:80097859-80097881
Sequence CACCTCAGTGCTTGCTACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120070561_1120070562 -4 Left 1120070561 14:80097859-80097881 CCGTTGTAGCAAGCACTGAGGTG No data
Right 1120070562 14:80097878-80097900 GGTGCATGAAGATCTTCCACTGG No data
1120070561_1120070566 13 Left 1120070561 14:80097859-80097881 CCGTTGTAGCAAGCACTGAGGTG No data
Right 1120070566 14:80097895-80097917 CACTGGTTAAGGGACATTAGTGG No data
1120070561_1120070563 2 Left 1120070561 14:80097859-80097881 CCGTTGTAGCAAGCACTGAGGTG No data
Right 1120070563 14:80097884-80097906 TGAAGATCTTCCACTGGTTAAGG No data
1120070561_1120070564 3 Left 1120070561 14:80097859-80097881 CCGTTGTAGCAAGCACTGAGGTG No data
Right 1120070564 14:80097885-80097907 GAAGATCTTCCACTGGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120070561 Original CRISPR CACCTCAGTGCTTGCTACAA CGG (reversed) Intergenic
No off target data available for this crispr