ID: 1120070819

View in Genome Browser
Species Human (GRCh38)
Location 14:80100349-80100371
Sequence GAATCCCACCCAGGCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120070815_1120070819 24 Left 1120070815 14:80100302-80100324 CCTTTTTTTTTTCTTTTTCTCGA No data
Right 1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG No data
1120070814_1120070819 25 Left 1120070814 14:80100301-80100323 CCCTTTTTTTTTTCTTTTTCTCG No data
Right 1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120070819 Original CRISPR GAATCCCACCCAGGCTCACA TGG Intergenic
No off target data available for this crispr