ID: 1120073789

View in Genome Browser
Species Human (GRCh38)
Location 14:80133233-80133255
Sequence ATTCAATGTGAACATGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120073788_1120073789 13 Left 1120073788 14:80133197-80133219 CCAAGAGACATAAAAAAAAAACA No data
Right 1120073789 14:80133233-80133255 ATTCAATGTGAACATGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120073789 Original CRISPR ATTCAATGTGAACATGTTAA AGG Intergenic
No off target data available for this crispr