ID: 1120076248

View in Genome Browser
Species Human (GRCh38)
Location 14:80161934-80161956
Sequence TCTTCACTAGAACCCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120076248_1120076250 1 Left 1120076248 14:80161934-80161956 CCATTTTGGGGTTCTAGTGAAGA No data
Right 1120076250 14:80161958-80161980 AAATCTTTTGTCTTATCAAAGGG No data
1120076248_1120076249 0 Left 1120076248 14:80161934-80161956 CCATTTTGGGGTTCTAGTGAAGA No data
Right 1120076249 14:80161957-80161979 GAAATCTTTTGTCTTATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120076248 Original CRISPR TCTTCACTAGAACCCCAAAA TGG (reversed) Intergenic