ID: 1120076249

View in Genome Browser
Species Human (GRCh38)
Location 14:80161957-80161979
Sequence GAAATCTTTTGTCTTATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120076248_1120076249 0 Left 1120076248 14:80161934-80161956 CCATTTTGGGGTTCTAGTGAAGA No data
Right 1120076249 14:80161957-80161979 GAAATCTTTTGTCTTATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120076249 Original CRISPR GAAATCTTTTGTCTTATCAA AGG Intergenic
No off target data available for this crispr