ID: 1120080446

View in Genome Browser
Species Human (GRCh38)
Location 14:80210542-80210564
Sequence GAGGCTTCCCTTACAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120080442_1120080446 30 Left 1120080442 14:80210489-80210511 CCCATCATCTCTTTCTAGGGCAA 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1120080446 14:80210542-80210564 GAGGCTTCCCTTACAAATGCTGG 0: 1
1: 0
2: 0
3: 3
4: 104
1120080443_1120080446 29 Left 1120080443 14:80210490-80210512 CCATCATCTCTTTCTAGGGCAAC 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1120080446 14:80210542-80210564 GAGGCTTCCCTTACAAATGCTGG 0: 1
1: 0
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120080446 Original CRISPR GAGGCTTCCCTTACAAATGC TGG Intronic
908094884 1:60727357-60727379 GAGCCTTCCTTTACGTATGCAGG + Intergenic
909184593 1:72470470-72470492 GATACTTGCCTTAGAAATGCAGG + Intergenic
909779004 1:79519347-79519369 GATGCTTCCGTAACAACTGCAGG + Intergenic
910803052 1:91164469-91164491 GAGTCTCCTGTTACAAATGCAGG + Intergenic
911380848 1:97112249-97112271 TTGACTTCCCTTATAAATGCTGG - Intronic
912780681 1:112544213-112544235 TAGTCATCCCTTACTAATGCAGG - Intronic
913247372 1:116881877-116881899 GAGGCATCACTTGCAAGTGCCGG + Intergenic
914727331 1:150338820-150338842 GATACATCACTTACAAATGCAGG - Intronic
920626458 1:207606370-207606392 GAGGGTTCCATTACTAATGAAGG + Intronic
1063578434 10:7282952-7282974 GAGGTTTCCCATTCAAAGGCCGG + Intronic
1065517311 10:26537222-26537244 TTGCCTTCCCTTCCAAATGCAGG + Intronic
1068916878 10:62442496-62442518 CAGGCTTACGTTACAATTGCTGG + Intronic
1071980393 10:90999277-90999299 TAGGCTTCCTTTGCAAATGGGGG + Intergenic
1075310350 10:121408413-121408435 GAGGCTTTCCTTATAAACGCTGG - Intergenic
1076598662 10:131642830-131642852 GCAGCTTTTCTTACAAATGCAGG + Intergenic
1078208695 11:9252686-9252708 GAGGCTTGCCTTTCAGAAGCTGG - Intronic
1080229233 11:29999942-29999964 GATGGTTCCTTTACAAATTCTGG - Intergenic
1089190229 11:116648386-116648408 GAGGCTTCCCTGACTCATCCAGG - Intergenic
1091784781 12:3236696-3236718 GATGATTCCCCTACAAAGGCTGG - Intronic
1091949552 12:4581523-4581545 GAGGCTTTCCTTCCAAAAGAAGG + Intronic
1093420730 12:18971412-18971434 GAGGCTTTCCTTCCAAAGGAAGG - Intergenic
1100482157 12:94989579-94989601 GAAGCTTCCCATACAAATAAGGG + Intronic
1106116088 13:26819025-26819047 GAGGCATCCCTCACTAAGGCAGG + Intergenic
1109338063 13:61018099-61018121 GAGAATACCCTTACAAATTCTGG + Intergenic
1112756867 13:102645416-102645438 GCAGCTCCCCTTACAAAAGCAGG + Intronic
1114864406 14:26571033-26571055 CAGACTTCACTTACAAAGGCTGG + Intronic
1116064875 14:39970208-39970230 GAGGCTTCCTTTACCAACCCAGG + Intergenic
1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG + Intronic
1118534356 14:66743138-66743160 GAGGCCTCCCTTACATCTGAGGG + Intronic
1120080446 14:80210542-80210564 GAGGCTTCCCTTACAAATGCTGG + Intronic
1126459870 15:48903620-48903642 TAGGCTTCCCTTGCACATGCAGG + Intronic
1127800541 15:62473597-62473619 GAACCTTCCCTTACAAACACAGG - Intronic
1129610643 15:77052804-77052826 CAGGCTGCCATTACAATTGCTGG + Exonic
1130057649 15:80541987-80542009 AGGGCCTCCTTTACAAATGCTGG + Intronic
1131557521 15:93412796-93412818 GAGGCTTCTCTTGGAAAAGCTGG - Intergenic
1132215981 15:100061944-100061966 GGGGCTTCCAATGCAAATGCTGG + Intronic
1132682045 16:1146398-1146420 GAGGCTTCCCTGACACATTTGGG + Intergenic
1137805099 16:51297473-51297495 GAGGCTGCCCTTCCAAATTTTGG + Intergenic
1139286117 16:65815962-65815984 GATGCTTCCCTTACAAAATGGGG + Intergenic
1146405633 17:32534694-32534716 GATGTTTCTCTGACAAATGCTGG + Intronic
1147762235 17:42806338-42806360 GAGCTTTCCCTGACAAGTGCCGG - Intronic
1152678115 17:81651852-81651874 GAGGCTTCCCTCACAGACCCAGG + Intronic
1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG + Intronic
1157001985 18:43537886-43537908 TAGGCTTACTTTAAAAATGCAGG - Intergenic
1157484225 18:48075610-48075632 GAGGCTTCCCCTGCAGCTGCAGG + Intronic
1164912750 19:32025980-32026002 TAGGCTTCCCCTGCAAATGGCGG - Intergenic
1166269461 19:41705134-41705156 GAGGCTTCCCAGCCAACTGCAGG + Intronic
925549100 2:5050922-5050944 GAGGCTTCTCTTCCAGCTGCTGG - Intergenic
927739820 2:25558873-25558895 GAGGCCTCCCTTTGAAATTCTGG - Intronic
931109802 2:59098389-59098411 AATGCTTCCATTACAAATGGGGG + Intergenic
938236431 2:129710045-129710067 GAGCCTTCCCCTCCAGATGCAGG + Intergenic
945971587 2:216236534-216236556 GAGGCAAACCTTAAAAATGCTGG - Intergenic
947428045 2:230001628-230001650 AAGGCTTCCTTTTCAAATTCCGG + Intronic
1173790929 20:45827333-45827355 GAGGGTGCCCCTACAAATCCCGG - Exonic
1175186142 20:57180649-57180671 GAGGCTTCGAATACAAATGAAGG + Intronic
1176242841 20:64083071-64083093 GAGGCTACCCTTACATCTGGGGG + Intronic
1176305386 21:5120466-5120488 GAGGCTCCCCTGAAAACTGCAGG - Intronic
1179119779 21:38532379-38532401 TAGGCTTCCATTTCAAATGATGG + Intronic
1179794385 21:43774429-43774451 GAGGCATCCCCTGCACATGCAGG - Intronic
1179851669 21:44141565-44141587 GAGGCTCCCCTGAAAACTGCAGG + Intronic
950554188 3:13685378-13685400 GAGGTTTCCCATACAAATTTGGG + Intergenic
951055573 3:18142907-18142929 GAGGCATGCCTTCCAAATCCTGG + Intronic
961174076 3:124819917-124819939 GGTGCTTCCCTGGCAAATGCTGG - Intronic
966529242 3:180956140-180956162 GAGGATTTCCTTACACATTCGGG + Intronic
968279751 3:197467544-197467566 GAAGGTTTCCTTACAACTGCAGG - Intergenic
968360376 3:198142838-198142860 GCTGCTTCCCTGACACATGCAGG - Intergenic
968945163 4:3659834-3659856 GTGGCTTCCCTGACCAATGAGGG + Intergenic
970119061 4:12732284-12732306 CAGCCTCCCCTTCCAAATGCTGG - Intergenic
971295614 4:25387371-25387393 CAGGCTTCCCTTAGGAAAGCTGG - Intronic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
974354154 4:60790421-60790443 GAGGCTTCAGTAATAAATGCAGG - Intergenic
978656044 4:111066742-111066764 TAGTCTTCCTTTAGAAATGCAGG - Intergenic
991057575 5:62336279-62336301 GCGGCTCCTCTTAAAAATGCTGG + Intronic
991440783 5:66646291-66646313 GTGGCATCCCTTATAAATGTTGG - Intronic
995277886 5:110298144-110298166 GATGCTTCCCTTACTTATACAGG - Intronic
995827458 5:116316487-116316509 GAGCCTTCACTTACAGATTCTGG + Intronic
996121819 5:119681245-119681267 GAGGATTCCATTTCAAATGGAGG + Intergenic
997559079 5:134829366-134829388 GAGGTTTCCCTCACAACTTCTGG + Intronic
997730872 5:136174176-136174198 GAGGCTTCTCTTGTAGATGCAGG + Intronic
998414571 5:141936934-141936956 GAGGCTTCTCTTGCATAGGCTGG - Intronic
999654436 5:153798439-153798461 TAGGCTTCCCCTAAAAATCCAGG + Intronic
1004965495 6:20844882-20844904 GTGGCTTCTCTTACAAATAGAGG - Intronic
1005484382 6:26285707-26285729 GAGGCGTCTCTTGCAATTGCTGG + Intergenic
1005647446 6:27854781-27854803 GAAGCATCCCTTAGAAAGGCAGG - Intronic
1009355141 6:62734499-62734521 GATTCTTCCCTTAAAAATTCAGG - Intergenic
1012950601 6:105513846-105513868 CAGGCCACCCTTACAAATGAAGG - Intergenic
1014152927 6:118079639-118079661 GAGGCTGCCCTCAAATATGCTGG + Intronic
1016359905 6:143256030-143256052 GAGTCTTCCTTTACAAATGGTGG + Intronic
1019259625 7:73795-73817 GCTGCTTCCCTGACACATGCAGG + Intergenic
1020823042 7:12994398-12994420 ATGGCTTCCCTTACAGATGTAGG + Intergenic
1021758599 7:23880932-23880954 GAGGCTTGCCTTTTAAAAGCAGG - Intergenic
1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG + Intronic
1033837102 7:145328616-145328638 GAAGCTTGCCTTCCTAATGCTGG + Intergenic
1036180391 8:6579479-6579501 AACACTTCCCTTACTAATGCAGG - Intronic
1036781229 8:11649234-11649256 GAGGGTTCTATTACAAATGGTGG - Intergenic
1038224500 8:25643440-25643462 GAGGCCTCCCAAACAGATGCTGG - Intergenic
1039196402 8:35036329-35036351 GAGGGATCCCTTAAAACTGCAGG - Intergenic
1040536681 8:48316722-48316744 GAGGTCTTCCTTATAAATGCTGG - Intergenic
1041862442 8:62529922-62529944 GAGGCTTCCCCTACCAGTTCTGG + Intronic
1046532482 8:115465968-115465990 AAGGATTCCTGTACAAATGCAGG + Intronic
1049806502 8:144543302-144543324 GAGGTGTCCCTTTCACATGCAGG - Intronic
1050621332 9:7454973-7454995 CCTGCCTCCCTTACAAATGCAGG - Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1058938246 9:109789229-109789251 GAGGCTTGCCATACATATGATGG + Intronic
1062745075 9:138206668-138206690 GCTGCTTCCCTGACACATGCAGG - Intergenic
1185782960 X:2865104-2865126 GTGGCTGCCCTTACGAATGAGGG - Intronic
1190566795 X:51738679-51738701 GAGGCTTCCACTGCAACTGCAGG + Intergenic
1192989619 X:76435584-76435606 GAGGCTTGAGTTACAAATTCTGG - Intergenic