ID: 1120080829

View in Genome Browser
Species Human (GRCh38)
Location 14:80214260-80214282
Sequence GCTGCTGAAGTCTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120080829_1120080831 16 Left 1120080829 14:80214260-80214282 CCTGCAGTGGAGACTTCAGCAGC 0: 1
1: 1
2: 0
3: 20
4: 212
Right 1120080831 14:80214299-80214321 CTCACTTGCTTTTGCTCTGAAGG 0: 1
1: 0
2: 3
3: 20
4: 255
1120080829_1120080832 19 Left 1120080829 14:80214260-80214282 CCTGCAGTGGAGACTTCAGCAGC 0: 1
1: 1
2: 0
3: 20
4: 212
Right 1120080832 14:80214302-80214324 ACTTGCTTTTGCTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120080829 Original CRISPR GCTGCTGAAGTCTCCACTGC AGG (reversed) Intronic
900097144 1:944456-944478 GCTGCTGAAGTCAGCTCCGCGGG - Exonic
900566162 1:3332968-3332990 TCTGCTGCAGACTCCTCTGCTGG + Intronic
900947957 1:5841833-5841855 GCTGCTGAGGACTCCACCACCGG - Intergenic
901130101 1:6956972-6956994 GCTGCTGCAGTCTTCCCAGCTGG + Intronic
902042342 1:13502052-13502074 GCCCCTGTAGTCCCCACTGCTGG - Intronic
902413905 1:16227832-16227854 GCTGCTGAAGGCTCTTGTGCGGG + Intergenic
902660894 1:17902793-17902815 GCTGCTGAGGGCTCCCTTGCTGG - Intergenic
904432959 1:30476971-30476993 GCTGTTGCCGGCTCCACTGCTGG - Intergenic
904883875 1:33721154-33721176 CCAGCTGAAGTCTCAACTCCAGG + Intronic
906152629 1:43596383-43596405 GCTGCTGAAGTCCCCATGGCAGG + Intronic
906288225 1:44602377-44602399 GTTGCTGTCCTCTCCACTGCAGG - Intronic
908064734 1:60390449-60390471 GGTGCTTAAGTGTCCACTGGTGG + Intergenic
914193390 1:145430561-145430583 GATGCTTAAGTCACCACAGCAGG + Intergenic
916347616 1:163811656-163811678 CCTGCTCAAGTATCTACTGCAGG - Intergenic
919926228 1:202193263-202193285 GCTGCGGAGGGTTCCACTGCAGG - Intergenic
920022929 1:202969073-202969095 GCTTCTGACATCCCCACTGCTGG + Intergenic
922038374 1:221871972-221871994 GCTGGTGAAGCATCAACTGCTGG + Intergenic
923113272 1:230910181-230910203 GCCTCTGAAGTCTTCCCTGCTGG - Intronic
923384458 1:233452871-233452893 CATGCTAAAGTCTCCACTCCAGG + Intergenic
923657552 1:235931401-235931423 GCATCTCTAGTCTCCACTGCAGG - Intergenic
1064027364 10:11859636-11859658 CCTGCAGGAGCCTCCACTGCGGG + Intronic
1064301544 10:14127287-14127309 GCTGCTGAATTAGCCAGTGCTGG + Intronic
1064614529 10:17139083-17139105 GCTGCTGAAGTCCCCATTCCGGG - Intergenic
1067078314 10:43200399-43200421 GCCACTGCAGTCCCCACTGCAGG + Intronic
1067545533 10:47189983-47190005 GCTGCTGATGCCACCTCTGCAGG - Intergenic
1069950489 10:72015002-72015024 GCTGCTGCAGGCTCCAGGGCTGG - Intergenic
1070627810 10:78063606-78063628 GATGGTGAAGTCTCCCCTGTGGG + Intergenic
1072226943 10:93379235-93379257 GCAGTGGAAATCTCCACTGCAGG - Intronic
1073179350 10:101574531-101574553 GGTGCTGGAGTCCCTACTGCAGG - Intronic
1073771995 10:106744950-106744972 GCTTCTGACGTCTCCATTCCAGG + Intronic
1074225207 10:111478134-111478156 CATGCTGAAGTTTCCACTCCAGG + Intergenic
1075429462 10:122368513-122368535 GCTGCTGGAGTCTCCAGCGTGGG + Intergenic
1076109216 10:127848469-127848491 GCAGCTGAAGTCTCATCTCCAGG - Intergenic
1076329715 10:129655252-129655274 GCTGCTCAGGTCTTCACTCCTGG - Intronic
1076408763 10:130231300-130231322 GCTCCTGCAGTGTCCACTCCTGG + Intergenic
1077094252 11:792646-792668 GCAGCTGGAGCCTCCACTGAGGG + Exonic
1077794069 11:5472417-5472439 GCTGGTGAAGTGTCCACTGAAGG + Intronic
1077906587 11:6539268-6539290 GCTGCTTACTTATCCACTGCTGG + Exonic
1079135375 11:17773482-17773504 GCTGCTGCAGTCCCTACCGCTGG - Intronic
1079763200 11:24356688-24356710 GCTGGTGCTGTATCCACTGCTGG - Intergenic
1080828373 11:35867268-35867290 GCTGGTGAACTCTTCACTACAGG - Intergenic
1084031201 11:66481557-66481579 GCTGCTGATGTCTCCATTGTGGG + Intronic
1084122383 11:67077334-67077356 GCTGCTGAAGGCTTCTGTGCAGG - Intergenic
1086121257 11:83306631-83306653 TCTGCAGAACTCTCTACTGCTGG + Intergenic
1087151918 11:94867219-94867241 GCTGCTGAAGCCACCAGTGGAGG - Intronic
1089378917 11:118013823-118013845 GCTGCTGATGTGACCACTGATGG + Intergenic
1089668745 11:120037345-120037367 GCAGCTGAGGTCTCATCTGCAGG - Intergenic
1090198502 11:124837851-124837873 GGAGCTGAAGTCTTCAGTGCTGG - Intergenic
1091268446 11:134288706-134288728 GCTGCCGAAGGCTGCACAGCTGG - Intronic
1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG + Intronic
1091648073 12:2288785-2288807 ACTGATGAAGGCTACACTGCAGG - Intronic
1091979190 12:4851798-4851820 GCTGCAGAAGTCTGGACAGCAGG + Intronic
1092488054 12:8919860-8919882 GCTGCTGACCTCTCACCTGCTGG - Exonic
1093000040 12:13986017-13986039 GCTGCTCAAGCCTCCAAAGCGGG - Intergenic
1095616186 12:44192202-44192224 GCTGCTGAAGACCTCACTGATGG - Intronic
1096603155 12:52744876-52744898 GTTGCTCCAGTCGCCACTGCTGG + Intergenic
1096621568 12:52868901-52868923 GCTGGTGAAGGCTCCAGTGAAGG + Intergenic
1096946635 12:55414547-55414569 GCTGCTGACCTCTCACCTGCTGG + Intergenic
1097171572 12:57117273-57117295 GCTGCTAAAGTCTTCACAGAAGG + Intronic
1099062025 12:77923704-77923726 GTTGGTCAAGTTTCCACTGCTGG - Intronic
1101879809 12:108618521-108618543 GGAGCTGAAGGCTCCACAGCAGG - Intergenic
1103721691 12:122978782-122978804 GCCGCTGATGACACCACTGCGGG + Exonic
1103951420 12:124553580-124553602 GATGCTGGACTCTGCACTGCTGG - Intronic
1104205606 12:126635423-126635445 GTGGCTGAAGTCTCCAGGGCAGG + Intergenic
1105070088 12:133229024-133229046 GCTTCTGAACTCTGCACTGCTGG + Intronic
1105427087 13:20303069-20303091 ACTGTTTAAGTCTCCACTGCAGG + Intergenic
1108066233 13:46580417-46580439 GCTGCAGTAGTTTCAACTGCTGG - Intronic
1108380157 13:49847382-49847404 GCTGCTGGTATCTACACTGCGGG - Intergenic
1108747646 13:53410939-53410961 GTTGCTTATCTCTCCACTGCTGG - Intergenic
1112217551 13:97449012-97449034 TATGCTAAAGTCTCCACTGTGGG - Intronic
1113738524 13:112695161-112695183 GCTGCTGGAGTCTACACCACAGG + Intronic
1116150112 14:41129967-41129989 GTGGATGAAGTCTCAACTGCAGG + Intergenic
1118086778 14:62426716-62426738 GTTGCTGAAGGTTTCACTGCTGG - Intergenic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1121308954 14:92924421-92924443 GCTGGGGAAGTCCCCACAGCAGG - Intronic
1121796269 14:96738131-96738153 GCTGGAGGCGTCTCCACTGCAGG + Intergenic
1122968686 14:105143764-105143786 GGTGGTGAAGTCGCCACTGCAGG - Intronic
1122968754 14:105143965-105143987 GCTGGTGAGGTCCCCACCGCAGG - Intronic
1123492721 15:20795471-20795493 GCTGCTGAATTAACCAGTGCTGG - Intergenic
1123549221 15:21364567-21364589 GCTGCTGAATTAACCAGTGCTGG - Intergenic
1125765840 15:42135420-42135442 GCAGCTGGAGTCCCCATTGCAGG - Intergenic
1132005546 15:98223294-98223316 GCTGAAGGAGTCTCCACTCCAGG - Intergenic
1202957557 15_KI270727v1_random:91783-91805 GCTGCTGAATTAACCAGTGCTGG - Intergenic
1132731727 16:1366230-1366252 CCCGCTGAGGTCACCACTGCAGG + Intronic
1132948532 16:2546873-2546895 GCTGCTGAGATCCTCACTGCTGG - Intronic
1132966055 16:2655253-2655275 GCTGCTGAGATCCTCACTGCTGG + Intergenic
1134562510 16:15222907-15222929 GCTACTGAAGCCTCATCTGCAGG - Intergenic
1134923050 16:18134534-18134556 GCTACTGAAGCCTCATCTGCAGG - Intergenic
1138370741 16:56524556-56524578 GCTGCTGGAGTCTCCTGTGCTGG - Intergenic
1141448530 16:84080509-84080531 GCAGCTCAGGTCTCCTCTGCAGG + Intronic
1141558119 16:84849317-84849339 GCTGCTGCTGTCTCCACTGGTGG + Intronic
1141698289 16:85630993-85631015 GCTGCTGCAGTATCCCCTGGGGG + Intronic
1142698896 17:1648013-1648035 GCGGCTGGCATCTCCACTGCTGG - Intronic
1143816545 17:9520268-9520290 GCTGCTGAAGTCTTGAAGGCAGG - Intronic
1147721369 17:42541591-42541613 GTTGCTGAAGTAGGCACTGCAGG + Intronic
1148386643 17:47238814-47238836 GCTGCTCCTGTCGCCACTGCTGG + Intergenic
1149671371 17:58415511-58415533 GCTGCTGATGGCTACCCTGCAGG - Exonic
1151499867 17:74481764-74481786 GCTGCTGATGTGGCCTCTGCAGG + Exonic
1152139483 17:78528126-78528148 ACTAGAGAAGTCTCCACTGCAGG - Intronic
1153721229 18:7905560-7905582 GCTGCAGAAGACTCCACTTCAGG - Intronic
1154450266 18:14470008-14470030 GCTGCTGAATTAACCAGTGCTGG - Intergenic
1157711624 18:49853625-49853647 GCTGCTGGAGGCTCAGCTGCAGG - Exonic
1157913396 18:51640245-51640267 ACTGCTGACGTCTACTCTGCTGG + Intergenic
1160420473 18:78740479-78740501 GCAGCTGCAGCCTCCACTGTGGG + Intergenic
1162097827 19:8321386-8321408 GCCGGTGACGTCTCCACCGCTGG + Exonic
1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG + Intergenic
1166287322 19:41839255-41839277 GCTGCACAAGTCTCAAATGCTGG + Exonic
1166408665 19:42541791-42541813 GCTGCTGACCTCCCCTCTGCGGG - Intronic
1168298794 19:55391281-55391303 GCTGCCCAAGTCCCCACAGCTGG - Intronic
925186949 2:1854474-1854496 GCTGCTGAAGTCTACACCAATGG + Intronic
925289986 2:2740941-2740963 GCTGCTGGAGAATCCCCTGCTGG + Intergenic
926044996 2:9703771-9703793 GCTGCCCCAGCCTCCACTGCTGG - Intergenic
926772761 2:16392934-16392956 ACTGCTGAGGGCTCCACTGGAGG - Intergenic
927451341 2:23211950-23211972 GCTGCTGTGGTCTGCCCTGCAGG - Intergenic
928952693 2:36827566-36827588 GCTCCTGAAGTCTGTTCTGCAGG - Intergenic
930467632 2:51774667-51774689 GCTTCTGTAGACTCCACTTCTGG - Intergenic
931436069 2:62248105-62248127 GCTGCTGAGGTCTTCACTTTGGG - Intergenic
931633701 2:64323378-64323400 GCTGCTGCAGCCTGCACTACCGG + Intergenic
933777224 2:85778561-85778583 GGTCCTGAAGTATCCACAGCCGG + Intronic
935396571 2:102616277-102616299 CCTCCTGAAGTTTCCAGTGCAGG + Intergenic
937051115 2:118891383-118891405 TGTGCTGAAGTCTACAATGCTGG + Intergenic
937200804 2:120203577-120203599 GCTGCTCAGCCCTCCACTGCAGG + Intergenic
938291268 2:130152084-130152106 GTGGCTTAAGTCTCCACTCCAGG - Exonic
938465277 2:131520875-131520897 GTGGCTTAAGTCTCCACTCCAGG + Intergenic
939316769 2:140560989-140561011 GCTTCTGAGGTCTTCACTTCGGG - Intronic
941233591 2:162941673-162941695 GCTGCTTAAGTCTCCAGCCCTGG - Intergenic
941713725 2:168742439-168742461 GCTGCTGAAGTGAGCTCTGCTGG + Intronic
942227066 2:173826397-173826419 TCTGCTGAACTATCCACTTCTGG - Intergenic
943176476 2:184481434-184481456 GCTGCTAACTTCTTCACTGCTGG + Intergenic
944887478 2:204078476-204078498 AGTGCTGCAGTCTCCACTTCTGG + Intergenic
948509584 2:238454747-238454769 GCTGCTGAAGAGGCCAGTGCTGG - Intergenic
948746192 2:240095810-240095832 GGTGCTGGAGTCTCGAGTGCAGG + Intergenic
1168968639 20:1915625-1915647 TTTGCTGAAGGCTCCACAGCTGG + Intronic
1169089077 20:2846922-2846944 GCTGCTGAGATTTCCACTTCTGG + Intronic
1169351154 20:4869015-4869037 GCTGCTAAGGTTTCCACTACAGG + Intronic
1170181371 20:13534056-13534078 GCTGCTGCTGTCTCCAGTGGAGG - Exonic
1170593147 20:17786517-17786539 GCTGCTGCAAACTTCACTGCTGG + Intergenic
1172062742 20:32197469-32197491 GCAGCTGAGGTCACCGCTGCTGG + Exonic
1176445920 21:6820354-6820376 GCTGCTGAATTAACCAGTGCTGG + Intergenic
1176824088 21:13685387-13685409 GCTGCTGAATTAACCAGTGCTGG + Intergenic
1177050077 21:16222323-16222345 CCTGTTGAAGTCTCATCTGCTGG + Intergenic
1178221557 21:30666395-30666417 GCTGAGTAACTCTCCACTGCTGG + Intergenic
1178307806 21:31504997-31505019 GTTTCTGAGGTCTCCAGTGCGGG - Intronic
1178666477 21:34551579-34551601 GCTGCTGAAGTTTCCACACTGGG + Intronic
1180154749 21:45972501-45972523 GCAGCTGAGCTCCCCACTGCCGG + Intergenic
1180610686 22:17095780-17095802 GCTCCTGAATTCTCCCCTACAGG - Intronic
1180938012 22:19638615-19638637 GCTCCTGAAGACACCCCTGCAGG - Intergenic
1183979058 22:41529211-41529233 GCTGCTGTTGTCTTCACAGCCGG + Exonic
1184253876 22:43276230-43276252 GCTGGAGAAGTGGCCACTGCTGG + Intronic
1185143078 22:49114201-49114223 TCTGCTGAAATCACCACTGAAGG - Intergenic
950003453 3:9675773-9675795 GCTGCTCAAATCAACACTGCAGG - Intronic
950835174 3:15912826-15912848 GCCTCTGTAGGCTCCACTGCTGG - Intergenic
954418167 3:50404297-50404319 ACTGCTGAAGTCTGCTCTCCAGG + Intronic
954627451 3:52030335-52030357 ACTGCAGAAGTCTCCACCACAGG - Intergenic
959100652 3:102006023-102006045 GCTGAGTAATTCTCCACTGCAGG + Intergenic
959580192 3:107975624-107975646 GTTGCTGAAGTCTGCTTTGCAGG - Intergenic
961811125 3:129522421-129522443 GCTGCTGAAGGCTGCACGGTGGG + Intergenic
966809444 3:183830372-183830394 GCTGCTGAAGCCTGTGCTGCAGG + Intronic
966971242 3:185047456-185047478 GCTGATGAACTCTGCAGTGCAGG + Intronic
967071739 3:185968368-185968390 GCTGCTGCAGTACCTACTGCAGG - Intergenic
967875451 3:194265525-194265547 GGTGCTGCAGGCTGCACTGCCGG - Intergenic
970040152 4:11787203-11787225 ACGGCGGAAGTCTCCTCTGCAGG + Intergenic
970151853 4:13098273-13098295 ACAGCTGAAGTCTCCATTCCAGG - Intergenic
970405467 4:15758911-15758933 GCTGGTGTTGTCTTCACTGCAGG + Intergenic
970515018 4:16820474-16820496 ACTGCTGAAGTCATCACTGACGG - Intronic
976367082 4:84244450-84244472 GCAGCTGAGGTCACCGCTGCTGG - Intergenic
978561078 4:110034144-110034166 GCTGCTGAGGTCTGCGGTGCAGG + Intergenic
981429881 4:144646185-144646207 GATGCTGAGGTCTCCTCTGCCGG - Exonic
983695714 4:170527565-170527587 GCTACTCAAGTATCCATTGCTGG + Intergenic
984410814 4:179395863-179395885 GCTGCTGACTTCTCCTCTGAAGG + Intergenic
985033524 4:185816264-185816286 TCTGCTGCAGACTCCACAGCTGG + Intronic
985484933 5:143167-143189 GCTGGGGAAGTCTCCTGTGCCGG - Exonic
985731035 5:1549061-1549083 GCTGCGGAAGACTCCAGGGCAGG - Intergenic
985794799 5:1953953-1953975 GCCTCTGTAGACTCCACTGCTGG + Intergenic
988566407 5:32322963-32322985 GCTGGTGAGGGCTCCACTCCAGG + Intergenic
991249255 5:64541522-64541544 GTTGCTGTCATCTCCACTGCTGG - Intronic
995939989 5:117570116-117570138 TCAGTTCAAGTCTCCACTGCTGG + Intergenic
997643742 5:135466759-135466781 GCTGCTGCCATCGCCACTGCTGG - Intergenic
1002661784 5:180796244-180796266 GCTGGTGAAGTCTCCCCAGGAGG - Intronic
1004192879 6:13479652-13479674 TCTGCAGAAGTTTCCACTGGAGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007348766 6:41252838-41252860 ACTGCTGATGTCTCCACTCCTGG + Intergenic
1007394064 6:41567327-41567349 CCTGCTCCAGTCTCCACTGCTGG - Intronic
1013106704 6:107031899-107031921 GCTTCTCAAGACTCCTCTGCTGG - Intronic
1018507264 6:164484725-164484747 GCTTCTGAAGTATTCACTTCAGG - Intergenic
1019268056 7:129923-129945 GCTGCTGAAGGCTCCAAGGATGG + Intergenic
1019933227 7:4237349-4237371 GATACTGAAGTCTCCAGGGCAGG + Intronic
1020434341 7:8146581-8146603 GCTGCTGCAGCCTGCACTGGAGG + Intronic
1021456244 7:20832187-20832209 GCTGCAGAAGTCCTCACAGCAGG - Intergenic
1023494943 7:40785193-40785215 GCTGCTGGATTGTCCACTCCTGG + Intronic
1025205838 7:56992957-56992979 GCTGCTGGAGCCTCCCCTGGGGG + Intergenic
1025666102 7:63583981-63584003 GCTGCTGGAGCCTCCCCTGGGGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1026904971 7:74057636-74057658 GCTGCTGGGGTCCCCACTCCTGG - Exonic
1028694364 7:93691723-93691745 ACTGCACAAATCTCCACTGCAGG - Intronic
1030047368 7:105509595-105509617 GCTGCTGTAGTCCCAGCTGCTGG - Intronic
1031097497 7:117438428-117438450 TCTGCTTAGGTCTCCTCTGCTGG + Intergenic
1032148023 7:129401480-129401502 GCTGCTGAAGGCTGCAGAGCAGG + Intronic
1032159791 7:129501929-129501951 GCAGGTGAAGTCTACACTTCGGG - Intergenic
1034860580 7:154591717-154591739 GCAGCTGTGGTCTCCTCTGCTGG - Intronic
1035022100 7:155806027-155806049 GCTTCTGGAGCCCCCACTGCAGG - Intronic
1035954678 8:4063625-4063647 GCACCTGATGTGTCCACTGCTGG - Intronic
1036397633 8:8382494-8382516 GCTGCTGAGGTCCACAATGCTGG + Intronic
1036427881 8:8663076-8663098 GCTGCTAGAGTCTACACTGCTGG - Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1041277559 8:56178641-56178663 GCTCCTGAACTCTTCACTGATGG - Intronic
1045411614 8:101926169-101926191 GCTGCTGATGGCTCTGCTGCTGG - Intronic
1047156533 8:122325574-122325596 GCTGCGGAAGTATCCACTGTTGG - Intergenic
1047410307 8:124619273-124619295 GCTTCTGTACACTCCACTGCTGG + Intronic
1047701460 8:127453173-127453195 GATGCACAAGTCCCCACTGCAGG - Intergenic
1048448235 8:134509053-134509075 GATGGTGAAGTCTCCACTGAGGG + Intronic
1049336488 8:142089405-142089427 GCTGCTGCAGTCTCCACTGCTGG - Intergenic
1049394883 8:142395368-142395390 GCTGTTGAAGTCTCCGCTGGGGG - Intronic
1049729405 8:144168202-144168224 GCTGCAGGTGTGTCCACTGCAGG + Intronic
1053208656 9:36209096-36209118 CCTGCTGAAGTCTCCAGCGCTGG + Intronic
1057303746 9:93900884-93900906 TCTGAGGAAGTCTCCATTGCTGG - Intergenic
1057427131 9:94961151-94961173 ACTGCAGAAGTTTCCACAGCAGG - Intronic
1058539081 9:105993279-105993301 GCTGCTTCTGTCTCCTCTGCCGG + Intergenic
1058562233 9:106242246-106242268 GAGGCTGCAGTATCCACTGCAGG - Intergenic
1059909263 9:119024248-119024270 GCTGCAGTAGTTTGCACTGCTGG - Intergenic
1060604212 9:124899607-124899629 GTTGCTGAGGTCCCCCCTGCAGG + Intronic
1061273808 9:129558298-129558320 CCTGCTCCAGCCTCCACTGCGGG + Intergenic
1062590755 9:137273454-137273476 GCCGCTGAAGGCAGCACTGCTGG - Exonic
1203523273 Un_GL000213v1:64171-64193 GCTGCTGAATTAACCAGTGCTGG - Intergenic
1187272121 X:17788738-17788760 GCTGCTGACCTCTCCACCACGGG - Intergenic
1189531910 X:41893364-41893386 GCTGCTTAAGTCTGCAATACTGG + Intronic
1191808704 X:65163367-65163389 GCTTCTGTAGGCTCCACTTCTGG - Intergenic
1192759865 X:74085933-74085955 GCTGCTGCTGCTTCCACTGCTGG + Intergenic
1195680270 X:107540506-107540528 GCTGCTGAATTCTGCACTGAGGG + Intronic
1196214623 X:113035928-113035950 GCTGCTGCTGCCGCCACTGCTGG + Intergenic
1196892630 X:120305889-120305911 CCTGCTGAAGTCTCCAAGGGAGG + Intronic
1200032127 X:153305339-153305361 GGTCCTAAAGTCTCCACTTCTGG - Intergenic
1201936719 Y:19418469-19418491 GCTGCTGTAGGCTCCACCTCCGG - Intergenic