ID: 1120080831

View in Genome Browser
Species Human (GRCh38)
Location 14:80214299-80214321
Sequence CTCACTTGCTTTTGCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120080829_1120080831 16 Left 1120080829 14:80214260-80214282 CCTGCAGTGGAGACTTCAGCAGC 0: 1
1: 1
2: 0
3: 20
4: 212
Right 1120080831 14:80214299-80214321 CTCACTTGCTTTTGCTCTGAAGG 0: 1
1: 0
2: 3
3: 20
4: 255
1120080827_1120080831 18 Left 1120080827 14:80214258-80214280 CCCCTGCAGTGGAGACTTCAGCA 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1120080831 14:80214299-80214321 CTCACTTGCTTTTGCTCTGAAGG 0: 1
1: 0
2: 3
3: 20
4: 255
1120080826_1120080831 26 Left 1120080826 14:80214250-80214272 CCAGTGCTCCCCTGCAGTGGAGA 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1120080831 14:80214299-80214321 CTCACTTGCTTTTGCTCTGAAGG 0: 1
1: 0
2: 3
3: 20
4: 255
1120080828_1120080831 17 Left 1120080828 14:80214259-80214281 CCCTGCAGTGGAGACTTCAGCAG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1120080831 14:80214299-80214321 CTCACTTGCTTTTGCTCTGAAGG 0: 1
1: 0
2: 3
3: 20
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120080831 Original CRISPR CTCACTTGCTTTTGCTCTGA AGG Intronic