ID: 1120080832

View in Genome Browser
Species Human (GRCh38)
Location 14:80214302-80214324
Sequence ACTTGCTTTTGCTCTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120080830_1120080832 -10 Left 1120080830 14:80214289-80214311 CCAATTCTCTCTCACTTGCTTTT 0: 1
1: 0
2: 6
3: 142
4: 1304
Right 1120080832 14:80214302-80214324 ACTTGCTTTTGCTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 226
1120080828_1120080832 20 Left 1120080828 14:80214259-80214281 CCCTGCAGTGGAGACTTCAGCAG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1120080832 14:80214302-80214324 ACTTGCTTTTGCTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 226
1120080826_1120080832 29 Left 1120080826 14:80214250-80214272 CCAGTGCTCCCCTGCAGTGGAGA 0: 1
1: 0
2: 3
3: 13
4: 204
Right 1120080832 14:80214302-80214324 ACTTGCTTTTGCTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 226
1120080827_1120080832 21 Left 1120080827 14:80214258-80214280 CCCCTGCAGTGGAGACTTCAGCA 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1120080832 14:80214302-80214324 ACTTGCTTTTGCTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 226
1120080829_1120080832 19 Left 1120080829 14:80214260-80214282 CCTGCAGTGGAGACTTCAGCAGC 0: 1
1: 1
2: 0
3: 20
4: 212
Right 1120080832 14:80214302-80214324 ACTTGCTTTTGCTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120080832 Original CRISPR ACTTGCTTTTGCTCTGAAGG AGG Intronic