ID: 1120081212

View in Genome Browser
Species Human (GRCh38)
Location 14:80218674-80218696
Sequence CCAAACACTGCATTTTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120081212_1120081218 -8 Left 1120081212 14:80218674-80218696 CCTCAACAAAATGCAGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1120081218 14:80218689-80218711 GTGTTTGGGCCTGGCAAGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 217
1120081212_1120081217 -9 Left 1120081212 14:80218674-80218696 CCTCAACAAAATGCAGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1120081217 14:80218688-80218710 AGTGTTTGGGCCTGGCAAGGTGG 0: 1
1: 0
2: 3
3: 116
4: 1120
1120081212_1120081225 28 Left 1120081212 14:80218674-80218696 CCTCAACAAAATGCAGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1120081225 14:80218725-80218747 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1120081212_1120081221 19 Left 1120081212 14:80218674-80218696 CCTCAACAAAATGCAGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1120081221 14:80218716-80218738 GCCTCTAATCCCAGCACTTTGGG 0: 1958
1: 240019
2: 277704
3: 178275
4: 139439
1120081212_1120081220 18 Left 1120081212 14:80218674-80218696 CCTCAACAAAATGCAGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1120081220 14:80218715-80218737 TGCCTCTAATCCCAGCACTTTGG 0: 897
1: 102898
2: 241789
3: 242349
4: 212894
1120081212_1120081223 22 Left 1120081212 14:80218674-80218696 CCTCAACAAAATGCAGTGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1120081223 14:80218719-80218741 TCTAATCCCAGCACTTTGGGAGG 0: 2826
1: 319470
2: 266870
3: 145698
4: 131355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120081212 Original CRISPR CCAAACACTGCATTTTGTTG AGG (reversed) Intronic
901199510 1:7458584-7458606 CTTAACACTGCACTTTCTTGGGG - Intronic
906986069 1:50684564-50684586 AAAAACACTGCTTTTTGTTTTGG - Intronic
907541928 1:55223371-55223393 AGAAACACTGCATTTTCCTGTGG + Intergenic
907551203 1:55306218-55306240 CCATTCTCTGCATGTTGTTGAGG - Intergenic
909330818 1:74408178-74408200 CCATGCACTGTATTTTGTCGTGG - Intronic
910064240 1:83134302-83134324 CGAACAACTGTATTTTGTTGGGG - Intergenic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
912686966 1:111775498-111775520 CAAAACAATGCATTTTGTGAGGG - Intronic
916929195 1:169557247-169557269 CCAAACATTCCATTTTGCCGTGG - Intronic
921422439 1:214964050-214964072 CCAAACTATGCATTTTGGGGTGG + Intergenic
921969865 1:221136278-221136300 GCACCCACTTCATTTTGTTGAGG - Intergenic
924372404 1:243365616-243365638 CCAAAAATTGCCTTTTGTTCTGG + Intronic
1063943421 10:11154334-11154356 CCAAATACTACATTTTGATTTGG - Intronic
1065388431 10:25157303-25157325 GCAAACAGTGCTTTTTCTTGAGG - Intergenic
1066284165 10:33948271-33948293 ACAAAAACAGTATTTTGTTGTGG + Intergenic
1066515679 10:36157694-36157716 CCTGACACTGCATTTTGGTCAGG + Intergenic
1067018579 10:42775782-42775804 CCAGACACTGCCTTTGGATGAGG + Intergenic
1069768323 10:70880541-70880563 TCAAACCCTGCATTTGGTTTAGG + Exonic
1070228531 10:74538489-74538511 CAAAATTCTGCAGTTTGTTGTGG + Intronic
1073451480 10:103612181-103612203 CCCAATAATGCCTTTTGTTGAGG - Intronic
1074816325 10:117143547-117143569 CCAGACAGTGCATCTTGTTCGGG - Intergenic
1075618281 10:123907389-123907411 CCTAAAACTGCATTTACTTGGGG + Intronic
1076266105 10:129110980-129111002 CCACACACTGCATGCTGCTGAGG + Intergenic
1076617113 10:131762640-131762662 TCAAATAATGCATTTTGGTGTGG - Intergenic
1078174261 11:8957597-8957619 CCAAAAAGTACATTTTGGTGGGG - Intronic
1079102373 11:17549675-17549697 CCAAACACTTCATTTCCCTGTGG + Intronic
1081633007 11:44702069-44702091 CCTTACACTGGATTTTGTGGGGG - Intergenic
1081884242 11:46481255-46481277 CCAAACAATGAATTGTGTAGTGG - Intronic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1086242211 11:84708737-84708759 CCAACCATAGCAATTTGTTGGGG + Intronic
1089425939 11:118374963-118374985 CCAAACACTGTATCTTGTCCTGG + Exonic
1089627881 11:119762945-119762967 CCATACACAGCATTAAGTTGAGG + Intergenic
1090368805 11:126231371-126231393 GCAATAACTGCATTTTGTTTAGG + Intronic
1090628510 11:128626484-128626506 GCAATCACTGCATTATGTTGTGG - Intergenic
1096119357 12:49077497-49077519 CCAAACAATACTTTTTGTTTTGG + Intergenic
1096349625 12:50885335-50885357 CCTAACACTTCATTTTGTGCAGG + Exonic
1097907641 12:64936767-64936789 CAAAACATTTCATTTAGTTGGGG + Intergenic
1098574501 12:72025678-72025700 CCAAAAAGTGCATTTGGGTGGGG + Intronic
1098751993 12:74305130-74305152 CCAAACTCAGCATTTTACTGGGG - Intergenic
1099346479 12:81506498-81506520 CCAAATACTGTATTTGGTTTGGG - Intronic
1099562728 12:84198180-84198202 CCACACACTGGAGTTTTTTGGGG + Intergenic
1102388530 12:112531146-112531168 CCATACACTGCATTTCTCTGTGG - Intergenic
1102521911 12:113483073-113483095 CCAATGACTGCATTCTCTTGGGG - Intergenic
1102836277 12:116063533-116063555 CCAAACAATGCTTTTTGATTTGG - Intronic
1104137381 12:125953476-125953498 ACAATCCCTGCATTTTGATGTGG + Intergenic
1107799467 13:44090774-44090796 ACAAAAGCTACATTTTGTTGGGG + Intergenic
1108201139 13:48044616-48044638 CCAGACACTTCATTTTCTAGGGG + Intronic
1108405167 13:50093580-50093602 CCAGTCATTCCATTTTGTTGAGG - Intronic
1113322668 13:109250910-109250932 CCAAAACCTGCCTTTTGTTTGGG + Intergenic
1113999598 14:16401227-16401249 CCAATCACTGCTTTCTCTTGCGG - Intergenic
1114792508 14:25675432-25675454 ACAAACAGTGCAATTTGATGTGG - Intergenic
1116507949 14:45708560-45708582 TCAAACACAGAATATTGTTGAGG - Intergenic
1118015800 14:61659300-61659322 CAAAACACTGCATTTTGGTTTGG - Intergenic
1118903164 14:70003358-70003380 TCAAGCACTGGATTTTCTTGGGG - Intronic
1119048989 14:71347254-71347276 CAAAATACTACATTTTGTTTGGG - Intronic
1119854052 14:77886209-77886231 CCAACAACTGCCTTTTGTTCCGG - Intronic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1121111442 14:91315867-91315889 CCCATCAGTGCATTCTGTTGGGG - Intronic
1124406920 15:29401144-29401166 TCAAGCACTGCATTTTGGTGTGG + Intronic
1126429155 15:48562183-48562205 CCAATCTCTGCTTTTTGTAGAGG - Intronic
1128106633 15:65050142-65050164 CCAAACTCTGCTCTGTGTTGAGG - Intronic
1129618829 15:77124082-77124104 ACCAACATTGCATTTTCTTGAGG + Intronic
1130410438 15:83643283-83643305 CCAAACCCTGTATTCTGTTGGGG + Intergenic
1133262530 16:4560542-4560564 CCAATCTCTGCTTTTTTTTGTGG - Intronic
1134411107 16:14003780-14003802 CCAAACACTGCATTTCATGAGGG + Intergenic
1135825163 16:25720672-25720694 CCAAACACTGTATTTTAGTGTGG - Intronic
1137995148 16:53202351-53202373 CCACATGTTGCATTTTGTTGAGG + Intronic
1139228293 16:65254698-65254720 CCAAACACTACATTTTACAGAGG + Intergenic
1140805055 16:78525585-78525607 GCATCCACTGCATTTTGTAGGGG + Intronic
1140806407 16:78536225-78536247 CTAAAAACTTCATTTTGGTGGGG - Intronic
1140966963 16:79976241-79976263 CCAAACAATTCATTGTGTGGAGG + Intergenic
1141078827 16:81033395-81033417 CCAAACAAGGCATTTTGATTGGG - Intergenic
1145297269 17:21601529-21601551 CCCAACACTGGACCTTGTTGGGG + Intergenic
1145366685 17:22271371-22271393 CCTGACACTGGACTTTGTTGGGG - Intergenic
1147050455 17:37790495-37790517 CCATCCACTGCATTGTGTGGAGG + Intergenic
1149459990 17:56820735-56820757 CCAAACACAACTTTTTGTTTGGG + Intronic
1149697855 17:58630501-58630523 CCAAACAGCACTTTTTGTTGCGG - Exonic
1149726512 17:58899909-58899931 CCCACCACTGCATTCTGTTTAGG - Intronic
1151364092 17:73605937-73605959 CCAAACTCTACAGTTTGCTGTGG - Intronic
1153191134 18:2540103-2540125 CTGAACATTGTATTTTGTTGGGG + Intronic
1162611301 19:11755954-11755976 CCTAACACTGTGATTTGTTGAGG - Intergenic
1164345689 19:27253621-27253643 TCAAAAACTGCATTGTGATGTGG + Intergenic
1165336337 19:35172635-35172657 CCAAACCCTGCAGTTTCTTTGGG - Intergenic
1167985518 19:53311451-53311473 CCAACCAATGCATTTTTTTATGG + Intergenic
1168664040 19:58189304-58189326 CCAAACACTTTAGTGTGTTGTGG + Intronic
926495563 2:13582515-13582537 GTAAACACTGCATGTTGTTGTGG + Intergenic
927070964 2:19529060-19529082 CCCAACTCTGCATTTTGGTTGGG + Intergenic
927927314 2:27023096-27023118 CCAAACACTGCATGTAGGTAGGG - Intronic
931125112 2:59266561-59266583 CCAATCCCAGCATCTTGTTGTGG - Intergenic
932468810 2:71940491-71940513 CCAAACTCTTCATTTTGTTGGGG + Intergenic
932518327 2:72378363-72378385 AAAAACACTGCTTTTTGTTTGGG + Intronic
939240423 2:139551696-139551718 GCTAACACTTCATTTGGTTGAGG + Intergenic
939427696 2:142060632-142060654 CCAAACACTGCCATTCATTGCGG - Intronic
940049417 2:149446588-149446610 CCAACCACTCCATTTTCATGAGG - Intronic
940193764 2:151070057-151070079 ACACACACTTGATTTTGTTGGGG - Intergenic
941569894 2:167157094-167157116 GCACTCAATGCATTTTGTTGTGG - Intronic
941891721 2:170589131-170589153 CTAAACCCTGAATTTTCTTGGGG - Intronic
943917436 2:193654339-193654361 GGAATCACTGAATTTTGTTGTGG + Intergenic
943963021 2:194291544-194291566 CTAAAAACTGCATATTGTTATGG - Intergenic
945112868 2:206379692-206379714 AGAAACACTGAATTTTGCTGGGG + Intergenic
945287444 2:208096626-208096648 CCAATCACTGTATCTGGTTGTGG - Intergenic
948327374 2:237136643-237136665 CTAAACACAGTATTTGGTTGTGG + Intergenic
948986885 2:241531059-241531081 CCAATCACTGCACTTTGTCCGGG - Intergenic
1171727022 20:28633377-28633399 CCAATCACTGCTTTCTCTTGCGG - Intergenic
1171751239 20:29051241-29051263 CCAATCACTGCTTTCTCTTGCGG + Intergenic
1171791739 20:29532696-29532718 CCAATCACTGCTTTCTCTTGCGG - Intergenic
1171856608 20:30350192-30350214 CCAATCACTGCTTTCTCTTGCGG + Intergenic
1178797899 21:35762421-35762443 ACAACCCCTGCTTTTTGTTGCGG - Intronic
1178799367 21:35778143-35778165 CCAAACACTTGATTTGGTGGTGG + Intronic
1179266435 21:39807594-39807616 CCACACTCTGCATTTTGTAGAGG - Intergenic
1180391360 22:12285795-12285817 CCAATCACTGCTTTCTCTTGTGG - Intergenic
1180408382 22:12578959-12578981 CCAATCACTGCTTTCTCTTGTGG + Intergenic
949871310 3:8591888-8591910 CCACACACTGCAATTAGTTTAGG + Intergenic
950408494 3:12819345-12819367 CCATTCACTGCATTGTGCTGGGG + Intronic
951426520 3:22552654-22552676 TCAAACACTGCATGTGGTTCTGG + Intergenic
951684126 3:25325546-25325568 CCAGGCACTTCATTTTGTGGGGG + Intronic
954153395 3:48671062-48671084 CCAAACACTCCCCTTTCTTGGGG + Intergenic
956650337 3:71499019-71499041 CCATCCAATGCATTTTGTTCTGG - Intronic
957180190 3:76867744-76867766 AAAACCATTGCATTTTGTTGGGG + Intronic
957840925 3:85668349-85668371 CCAAACACTAGATTTATTTGAGG - Intronic
961483738 3:127201551-127201573 TCAAACACTGTATATTGTTGGGG - Intergenic
963296209 3:143549509-143549531 CCCCACACTGCCTTTTTTTGGGG - Intronic
964052159 3:152407956-152407978 ACATACACTGGAGTTTGTTGGGG + Intronic
964635772 3:158857510-158857532 TCAAAGACTTCATTTTGTTTTGG + Intergenic
965409693 3:168314412-168314434 CAAAACACTTCATTTTGTAAAGG + Intergenic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
969611753 4:8231575-8231597 CCACACACGGCATCATGTTGGGG - Intronic
970329855 4:14969305-14969327 ACAATCACTTCATTTTGTAGAGG - Intergenic
973059925 4:45710630-45710652 CCAAAAATTGCATTTTGGTTTGG - Intergenic
974094408 4:57346997-57347019 CGAAAAACTGCATGTTGTGGGGG + Intergenic
974168993 4:58241829-58241851 CTAAACACTGGATATTTTTGAGG - Intergenic
974389147 4:61242570-61242592 CCAAAGACTGGTTTTCGTTGGGG - Intronic
975175746 4:71286577-71286599 CCAAACATTACATGTTGTTATGG + Intronic
977128873 4:93208117-93208139 CCAAGTACTACATCTTGTTGAGG - Intronic
978165888 4:105606048-105606070 CCACACACAACATTTTGGTGAGG - Intronic
978907503 4:114025052-114025074 GCAAACACTGAGTTTAGTTGTGG + Intergenic
979731639 4:124030045-124030067 CCAAAAACTGTCTTGTGTTGAGG - Intergenic
981399467 4:144296419-144296441 CCTAAAACTGGATATTGTTGTGG - Intergenic
982371520 4:154638731-154638753 CCTCCCACTGCATTTTGTTAGGG + Intronic
984010392 4:174364162-174364184 GCAAACACTTTATTTTGATGAGG - Intergenic
984230441 4:177091326-177091348 CCAAACATTGCATTTTATTGTGG - Intergenic
984335652 4:178386388-178386410 ACACACACTGGAGTTTGTTGGGG + Intergenic
984511844 4:180688537-180688559 CCAAACACAGCTTTTTCCTGAGG - Intergenic
985433604 4:189905599-189905621 CCAATCACTGCCTTCTCTTGTGG + Intergenic
988520986 5:31945563-31945585 CCAAAGACAGAATTTTGGTGTGG - Intronic
989309307 5:39995877-39995899 CCAAACATCACATTTTGTTTGGG + Intergenic
993339898 5:86711699-86711721 CCAAATAATGCATTTTGATTTGG + Intergenic
993625367 5:90218060-90218082 CCTAACACTGTATTTACTTGTGG + Intergenic
993873026 5:93273946-93273968 CTAGACTCTGCCTTTTGTTGGGG + Intergenic
993996277 5:94727338-94727360 GCTAACACAGCATCTTGTTGGGG - Intronic
996333173 5:122354223-122354245 CCAGATACTTCATTTTGTTAAGG + Intronic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
997280353 5:132639707-132639729 CCTAACACTGGCTTTTGCTGAGG + Intronic
1000141418 5:158407543-158407565 GCAAAAACCGCATTTTTTTGTGG + Intergenic
1000475550 5:161702326-161702348 ACAAACACCACATTTTATTGAGG - Intronic
1000764915 5:165275187-165275209 CTAAACAATAAATTTTGTTGTGG + Intergenic
1000947367 5:167438051-167438073 TCAAACACTGCATTATTCTGTGG - Intronic
1001937818 5:175718198-175718220 CAAAACATTTCATTTTGTTTTGG - Intergenic
1004582878 6:16971504-16971526 ACAAACACTGCATTTGCTTAGGG - Intergenic
1004742287 6:18473689-18473711 CCAGTCACTGCCTGTTGTTGAGG + Intergenic
1005439559 6:25851367-25851389 CCTAACAATGCCTTTTGATGAGG + Intronic
1006242013 6:32690564-32690586 TAAAACACTGTATTTTTTTGTGG - Intergenic
1006970686 6:38041989-38042011 CCACACACGGCTTTTTTTTGGGG + Intronic
1009520758 6:64679637-64679659 CCACACACTGCAGTTGGGTGTGG - Intronic
1009538491 6:64922922-64922944 CCCAACATTTCATTTTGTTTAGG + Intronic
1009596328 6:65741416-65741438 CCAAGCTTTGCATTTAGTTGGGG - Intergenic
1009697152 6:67121395-67121417 TTAAACACTGTATTTTGGTGTGG - Intergenic
1010069003 6:71721113-71721135 TCAAATTATGCATTTTGTTGGGG + Intergenic
1010923294 6:81711600-81711622 TCACACACTGCAGCTTGTTGAGG + Intronic
1011521537 6:88212170-88212192 ACCAACACTCCATTGTGTTGTGG - Intergenic
1011799973 6:91001494-91001516 CCAAACATTGCATTTGGTTTTGG + Intergenic
1018096106 6:160388310-160388332 ACAAACAATACATTATGTTGTGG + Intronic
1018134425 6:160765934-160765956 GAAAACACTGCACTTTTTTGTGG - Intergenic
1018182687 6:161238035-161238057 CCAAGCACTGCTGTGTGTTGGGG + Intronic
1021025610 7:15662895-15662917 ACAGACAGTGCATTTTGTTCTGG + Intronic
1021711291 7:23418018-23418040 CCAAACTTTGCATTTTGATGGGG + Intronic
1023469749 7:40503232-40503254 GCAAACACTGAATATTGTTAAGG + Intronic
1026331941 7:69359774-69359796 TCAGACAATGGATTTTGTTGGGG + Intergenic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1027279868 7:76600440-76600462 CGAACAACTGTATTTTGTTGGGG + Intergenic
1028477927 7:91271693-91271715 AATAACACTGCATTTTCTTGAGG + Intergenic
1031784874 7:126016851-126016873 CCAAAGAATGCATTTTATTGAGG - Intergenic
1032185092 7:129717892-129717914 AAAGAAACTGCATTTTGTTGGGG + Intronic
1035986237 8:4434878-4434900 CAAAATACAGCATTTTCTTGAGG - Intronic
1038291812 8:26256534-26256556 GCAAACACATCATTTTGTTCTGG + Intergenic
1039614437 8:38943816-38943838 CCAAAAACTCCATTTTGCTTTGG + Exonic
1042919134 8:73905333-73905355 AGAAACACTGCATTTTCCTGTGG - Intergenic
1044407415 8:91844484-91844506 TCAAACACTGCATTTTTCTTTGG + Intergenic
1045364318 8:101461634-101461656 CCACACACTGCATTTTGACTTGG - Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1047883425 8:129221065-129221087 CCAAACACTGGATTGTGCTGTGG + Intergenic
1047939594 8:129816295-129816317 CTGAACACTGCAGTTGGTTGTGG - Intergenic
1048884123 8:138895089-138895111 AAAAACACTGTATTTTTTTGGGG + Intronic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1049210329 8:141383568-141383590 CCAAACACAGCCTGTTGCTGTGG - Intergenic
1051487051 9:17620293-17620315 CCATACACTGCATTTTGCACTGG + Intronic
1053722723 9:40963717-40963739 CCAATCACTGCTTTCTCTTGCGG + Intergenic
1054343242 9:63888280-63888302 CCAATCACTGCTTTCTCTTGCGG - Intergenic
1055258021 9:74395790-74395812 CCAATCACTGCATTTTGAGGTGG + Intergenic
1055324170 9:75111326-75111348 CCAAACACTGTATTTTCCTCTGG - Intronic
1055641895 9:78325343-78325365 ACACAGACCGCATTTTGTTGTGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1059129814 9:111735045-111735067 CCAAATACTGCATGTTCTAGTGG - Intronic
1059176551 9:112174435-112174457 CTCAACACTGCATTTTGCAGAGG + Intronic
1059572813 9:115458744-115458766 CTAACCACTGTATTTTGGTGGGG + Intergenic
1060853351 9:126895698-126895720 CCAAGCACTGCATTTTAGTGGGG - Intergenic
1203452444 Un_GL000219v1:132259-132281 CCAATCACTGCTTTCTCTTGCGG - Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1187585449 X:20656287-20656309 TCACTCACTTCATTTTGTTGAGG - Intergenic
1202168365 Y:22015903-22015925 CCAGACTCTGTATTTTGTTTTGG - Intergenic
1202222996 Y:22570465-22570487 CCAGACTCTGTATTTTGTTTTGG + Intergenic
1202320119 Y:23625195-23625217 CCAGACTCTGTATTTTGTTTTGG - Intergenic
1202550648 Y:26044861-26044883 CCAGACTCTGTATTTTGTTTTGG + Intergenic