ID: 1120085993

View in Genome Browser
Species Human (GRCh38)
Location 14:80273996-80274018
Sequence TGTTATGTAGCATTACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120085993 Original CRISPR TGTTATGTAGCATTACCTAA GGG (reversed) Intronic
901894894 1:12302932-12302954 TGTTCTGTAGAATTCCATAAGGG + Intronic
906950048 1:50327192-50327214 TGTTCTCTAGCATTATCCAAAGG - Intergenic
912586413 1:110771035-110771057 TGTTATGCAGCTCTACCTGAAGG - Intergenic
916330169 1:163606858-163606880 TGTTATGTGCCATTACAGAATGG - Intergenic
918656748 1:187036203-187036225 TGAAATGTAGCATTACAAAAGGG + Intergenic
919012074 1:191977428-191977450 TGTTAATTGGCATTATCTAAAGG - Intergenic
919109254 1:193197293-193197315 TATTATATACCATGACCTAATGG - Intronic
923239296 1:232065231-232065253 TATTATGAAGCAATAGCTAAAGG + Intergenic
1063075287 10:2710662-2710684 TGTTATGTAGCAACAAATAATGG + Intergenic
1068211977 10:53932234-53932256 TGTTCGGTAGGATTACCTGAAGG - Intronic
1073826209 10:107325162-107325184 TTTGATGTAACATTACATAAAGG + Intergenic
1079890555 11:26047745-26047767 TGTTATCTAGCAATACTGAAAGG + Intergenic
1081739926 11:45431624-45431646 TGTCAATTAGCATTAGCTAAGGG + Intergenic
1087056503 11:93941731-93941753 GGTTATGTACCATAACCAAATGG + Intergenic
1087135224 11:94709799-94709821 TTTTATGTAGCATTAGATAATGG + Intronic
1088587657 11:111373869-111373891 TGTTATTAAGCATTTCATAAAGG + Intronic
1090906309 11:131077350-131077372 CTTTATGTGGCATTTCCTAAAGG - Intergenic
1098177765 12:67810708-67810730 TCTTATGTATCATTACCCAAGGG - Intergenic
1098177773 12:67810790-67810812 TCTTAGGTATCATTACCCAAGGG - Intergenic
1100737377 12:97551717-97551739 TGATATGAAGCATAACCTAAGGG - Intergenic
1100912659 12:99383117-99383139 TGTGCTGTAGCTTTGCCTAAAGG - Intronic
1103571715 12:121849334-121849356 ACTTATGTAGCATTTACTAATGG + Intronic
1103645313 12:122387478-122387500 TGTGATGAAGCATTTCATAAAGG + Intronic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1107728603 13:43325453-43325475 TGTAATTTAGCATTAGTTAATGG + Intronic
1110162151 13:72391166-72391188 TATTATGTGGCAATACCGAATGG + Intergenic
1110716402 13:78709978-78710000 TGTCATGTAGCATGAGCTAAAGG - Intergenic
1110928213 13:81182594-81182616 TGTTAATTAGCTTTACCCAAAGG + Intergenic
1111188099 13:84770146-84770168 AGTTATGTACCATTATGTAAAGG - Intergenic
1113302944 13:109042727-109042749 TGTTAAATAATATTACCTAAGGG - Intronic
1114435264 14:22701028-22701050 ATTTATGTAGCATTTCCTAGGGG - Intergenic
1115744559 14:36422955-36422977 TGTTATTAAGCAGTACCTGATGG + Intergenic
1116251824 14:42494894-42494916 TGTTATTTAGCAGTTCCAAATGG - Intergenic
1116503272 14:45647018-45647040 TGTAAGGTAGTATAACCTAAAGG - Intergenic
1120085993 14:80273996-80274018 TGTTATGTAGCATTACCTAAGGG - Intronic
1127345437 15:58092492-58092514 TGTTATGCAGCATTAGCCATGGG - Intronic
1132358800 15:101194559-101194581 TATTATGTAGCTTTATTTAATGG - Intronic
1134437111 16:14270249-14270271 TGTTATATAGCATGACCAAGTGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149014139 17:51888783-51888805 TATTATGTAGCAATAGGTAATGG - Intronic
1152511702 17:80794355-80794377 TTTTAATTTGCATTACCTAATGG - Intronic
1152976666 18:227869-227891 TGTTAGGTAGCATTAGTAAATGG - Intronic
1156145637 18:34174020-34174042 TCTTATGAAACATGACCTAATGG + Intronic
1158587890 18:58756898-58756920 TGTTATTTACCAATTCCTAAAGG + Intergenic
1159535508 18:69709695-69709717 GGTTATTTAGCATTAGCAAAAGG + Intronic
1159820464 18:73135259-73135281 TATTATGCAGCATTTGCTAATGG - Intergenic
1160037391 18:75314498-75314520 TGTTATATAGCAGCACCAAATGG + Intergenic
1160103080 18:75942149-75942171 TCTTATGTATCATTACCAAAAGG + Intergenic
926650152 2:15334842-15334864 TGTTATGTTTCTTTGCCTAAGGG - Intronic
931159418 2:59672458-59672480 TGTTTTGTAGCATTAGCTATGGG - Intergenic
931617247 2:64172554-64172576 TATTTTGTACAATTACCTAAGGG - Intergenic
931814237 2:65885008-65885030 TGTTATGAAGAATGACTTAATGG + Intergenic
933392627 2:81691253-81691275 TGTTATGCAGCAAAAGCTAAAGG - Intergenic
935892637 2:107695759-107695781 TGTAAAGTAGCATTACTCAAGGG + Intergenic
939658873 2:144862186-144862208 TAAAATGTAGAATTACCTAAAGG + Intergenic
940325279 2:152418733-152418755 CATTATGTAGAATAACCTAAAGG - Intronic
942117835 2:172746415-172746437 TGTTCTGTAGCATTACCTGTGGG - Intronic
944998691 2:205324147-205324169 TGTGACGTAGCAACACCTAATGG - Intronic
945419069 2:209612485-209612507 TGGTTTTTAGCATTACATAAAGG - Intronic
945554116 2:211258222-211258244 TGATATGTAGAATGACATAATGG + Intergenic
947823952 2:233091704-233091726 TGTTATGTACCATGGCCTGAGGG - Intronic
948964751 2:241369712-241369734 AGATTTGTAGCATTACTTAAGGG + Intronic
1173661347 20:44736235-44736257 TGTTACGTAACATTCCCTATGGG + Intergenic
1175747386 20:61467603-61467625 TGTTATGTAGAATTTGTTAATGG - Intronic
1175773490 20:61638384-61638406 TGTTCTGTAGAATATCCTAATGG + Intronic
1178564551 21:33671214-33671236 AGGTATGTACCATTCCCTAATGG - Intronic
1183855975 22:40635572-40635594 TGTTATGCAGCATAACGAAAGGG - Intronic
949233015 3:1773629-1773651 TGTTATCTCTCATTCCCTAAAGG + Intergenic
949287393 3:2422837-2422859 TGTTATATCTCATTACCTGATGG - Intronic
955998450 3:64702629-64702651 TGTTTTATAACATTACATAAAGG - Intergenic
957122702 3:76116183-76116205 TCTTTTGAGGCATTACCTAAGGG - Intronic
957420655 3:79965335-79965357 TACTATGTAACATTACATAAAGG - Intergenic
958146170 3:89628557-89628579 GGTTATGTAGCATGACCAAAAGG - Intergenic
960585760 3:119320139-119320161 TGGTATGTAGTATTACTTGAAGG + Intronic
961225962 3:125246366-125246388 TTTTATGTTGCATCACATAATGG - Intronic
963393764 3:144705062-144705084 TGTTATGTGGCCTAACATAATGG + Intergenic
964883064 3:161445841-161445863 TGTTCTGGAGCATCACCTGAGGG - Intergenic
967642299 3:191879947-191879969 TGTTATGCAGCTTTAGCTAACGG - Intergenic
968300275 3:197607643-197607665 TCCTGTGTAGCATTACCGAATGG - Intergenic
970508136 4:16753907-16753929 TGTTATGGAGCATTTTCAAAGGG + Intronic
971682905 4:29724422-29724444 TGTCATGTAGCATGTTCTAAAGG - Intergenic
974393436 4:61304400-61304422 TTTTTAGTAGCATAACCTAAAGG - Intronic
974818890 4:67040996-67041018 TGTTTGGTAGAATTACATAAGGG - Intergenic
976140467 4:81986319-81986341 ATTTATGGAGCATTTCCTAAGGG - Intronic
976682099 4:87768758-87768780 GGTTTTGTAGCAATACCAAAAGG + Intergenic
976949395 4:90810757-90810779 TGCTATGGAGCATTCCCAAAGGG + Intronic
977284895 4:95091184-95091206 TGTTATGTAACATTTCCAGATGG - Intronic
978446493 4:108785672-108785694 TGTTATGAAGCATTTCCCCAGGG - Intergenic
978687540 4:111464354-111464376 TGTCATGAAGCATTATCCAAAGG + Intergenic
978748452 4:112221606-112221628 TGTTATGCAGCAATAGATAATGG - Intergenic
978913417 4:114093994-114094016 TATTATGTAGCATTATGAAATGG - Intergenic
980900201 4:138897652-138897674 TGTTATTTAACTTCACCTAATGG + Intergenic
980935521 4:139221995-139222017 TGTTATGGAGAATTAGTTAAAGG + Intergenic
983439298 4:167761124-167761146 TGTTATATAACATTACCACAAGG - Intergenic
984305173 4:177980012-177980034 TGTTATGTATCTTTACAAAAAGG - Intronic
986409648 5:7464554-7464576 TGTTATGCAGCAGTAGATAAGGG + Intronic
987145394 5:14986711-14986733 TGTTAAGTAGCATAACCTACAGG - Intergenic
988360853 5:30234772-30234794 TGTTATGAACTATAACCTAAAGG - Intergenic
990699865 5:58462662-58462684 TGGTATGTATCTTTACCAAATGG + Intergenic
993949498 5:94156048-94156070 TTTTATATAGCATTAACTAATGG + Intronic
994660235 5:102644369-102644391 TGTTATGTTGAATTATGTAATGG - Intergenic
996198344 5:120638095-120638117 TGTTGTATAGCATTACCTCCAGG - Intronic
996470660 5:123856352-123856374 TGTTATCTAGTATTACTTAAAGG - Intergenic
996517339 5:124386374-124386396 AGTTATATAGCATGACCAAATGG + Intergenic
1001203151 5:169737652-169737674 TGTTATGTAGCATTGGCCATTGG - Intronic
1004980648 6:21019804-21019826 TGTTATTTAGCATCTCCTAGTGG - Intronic
1006205974 6:32343246-32343268 TGTTCTTTAGCTTTACCTCAAGG - Intronic
1009500793 6:64410224-64410246 TGTTCTGCAGCATTCCCTGATGG + Intronic
1010668826 6:78662095-78662117 TGTTATTCAGCATAACCTGATGG + Intergenic
1011161458 6:84395247-84395269 TTTTATGTAGCAAAACCAAATGG + Intergenic
1015644702 6:135373789-135373811 TCTTATGTATCATTACCAAGTGG + Intronic
1018347586 6:162918245-162918267 TGTAATTTAGTATTAGCTAATGG - Intronic
1020796058 7:12679838-12679860 TGTTATGTTGTTATACCTAATGG - Intergenic
1021266111 7:18524747-18524769 AGTTATATAGCACTGCCTAATGG + Intronic
1025626919 7:63231092-63231114 AGTTATGTTGATTTACCTAAAGG - Intergenic
1031343583 7:120636303-120636325 TGTTATGGAGGTTTACTTAAAGG + Intronic
1032365317 7:131293373-131293395 TGTTATGCAGTAATAGCTAATGG + Intronic
1032817020 7:135486322-135486344 TGTTTTCTTGCATTCCCTAATGG - Intronic
1034419595 7:150982317-150982339 TGTTATGCAGCAATAGGTAATGG - Intergenic
1036069681 8:5426919-5426941 TGTTATGTATCATGAGTTAATGG - Intergenic
1036757613 8:11481650-11481672 TGGTATTTATCAATACCTAAAGG - Intergenic
1037415272 8:18643299-18643321 TCTTATGAAGCCTTGCCTAATGG + Intronic
1038102923 8:24399625-24399647 TGTTCTGTCGCATAACCCAAGGG - Intronic
1038448770 8:27624879-27624901 TGTTATATAGCATCACCCACTGG + Intergenic
1042647792 8:71006508-71006530 TGTTAGGTAGAATTTCCTCATGG - Intergenic
1042845637 8:73167352-73167374 TGTTACGTAGCATTGCTAAATGG - Intergenic
1043068635 8:75609744-75609766 TGTTTGGTAGCATGAACTAATGG + Intergenic
1045481388 8:102595358-102595380 TCTTCTTCAGCATTACCTAATGG - Intergenic
1045544636 8:103117601-103117623 TGTTATGCAGCACTGGCTAATGG + Intergenic
1045796300 8:106049230-106049252 TGATATGTATCATTTACTAATGG - Intergenic
1046134046 8:110003794-110003816 TGTTATGGAGCACTGCCTAGTGG - Intergenic
1047726577 8:127689112-127689134 TGTTATGCAGCAGTAGATAATGG - Intergenic
1058377928 9:104345810-104345832 TGTTATGTAACATAAACAAATGG - Intergenic
1059581136 9:115549705-115549727 TCTTATGTTCCATTACCTAGAGG - Intergenic
1186524905 X:10239344-10239366 TCTCATGTAGCATTTCCAAAAGG - Intergenic
1186811611 X:13195098-13195120 TTTTATGCATCTTTACCTAAAGG + Intergenic
1187035115 X:15530203-15530225 TATTATGCAGCAATACATAATGG - Intronic
1188649961 X:32620255-32620277 TGGTATGTAACATTACATACAGG - Intronic
1190894408 X:54602608-54602630 TTTTATGTAATATAACCTAATGG - Intergenic
1191239808 X:58176787-58176809 TTTTTTGTAGAATTACCAAAGGG + Intergenic
1196393977 X:115239654-115239676 TGTTATGAGGCATCTCCTAATGG + Intergenic