ID: 1120088282

View in Genome Browser
Species Human (GRCh38)
Location 14:80300809-80300831
Sequence GTATAGACATTCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120088278_1120088282 30 Left 1120088278 14:80300756-80300778 CCATTTAATGCCTTGGATAACAG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1120088282 14:80300809-80300831 GTATAGACATTCAGGGAAGATGG 0: 1
1: 0
2: 1
3: 13
4: 204
1120088279_1120088282 20 Left 1120088279 14:80300766-80300788 CCTTGGATAACAGTTGTAATTAT 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1120088282 14:80300809-80300831 GTATAGACATTCAGGGAAGATGG 0: 1
1: 0
2: 1
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120088282 Original CRISPR GTATAGACATTCAGGGAAGA TGG Intronic
901784901 1:11618040-11618062 GTTAAGACATTTTGGGAAGATGG + Intergenic
902136583 1:14311478-14311500 CTATAGAGATTTAGAGAAGATGG + Intergenic
904068862 1:27777179-27777201 GGGTAGAGAGTCAGGGAAGAGGG + Intronic
904279086 1:29405844-29405866 GAATAGACATACAGAGAAGCTGG + Intergenic
906293971 1:44637730-44637752 GTGTAAACACTCAGGGAAAACGG - Intronic
906798648 1:48717282-48717304 GTATAAACACTCAGGCAGGAAGG - Intronic
909719621 1:78753295-78753317 GTAGAGACAATCAGGGCAAAAGG + Intergenic
911379578 1:97095876-97095898 GTATGGACATTCTGGGGAGAAGG + Intronic
911895715 1:103432444-103432466 ATATAAACATTCAGAGAAGCTGG + Intergenic
913229985 1:116733795-116733817 TTATTGGCTTTCAGGGAAGAGGG - Intergenic
914404391 1:147356716-147356738 GAGAAGACATTCAAGGAAGAAGG + Intergenic
915661211 1:157407131-157407153 GGAATGACATTCATGGAAGATGG + Intergenic
917716119 1:177739812-177739834 GTGAAGACATTCAGGGTATAAGG - Intergenic
917921728 1:179756219-179756241 GTACAGACAGTCAGGAAAGAAGG + Intronic
922471140 1:225878045-225878067 GGATAAACAACCAGGGAAGAAGG + Intronic
923923633 1:238598354-238598376 GTAAAGACATTGGAGGAAGATGG - Intergenic
1063650872 10:7935654-7935676 TTTTAGATATTCAGGGAAGGGGG + Intronic
1067723556 10:48749043-48749065 GTATCTACATTGAGGGAAGATGG + Intronic
1067794613 10:49311719-49311741 GAAGAGACATTCCAGGAAGAGGG + Intronic
1068002889 10:51357145-51357167 GTATAGACATACATGGCAGCAGG + Intronic
1068117472 10:52750765-52750787 GGCTAGAGATTCAGTGAAGAGGG + Intergenic
1068723615 10:60275272-60275294 CTATAAACATTCAGAGCAGAAGG - Intronic
1069125115 10:64621048-64621070 GTAAAGACATTCACAGATGAAGG + Intergenic
1069911401 10:71761975-71761997 GGACAGACATACAGGGAATACGG + Exonic
1073072710 10:100805101-100805123 GAATAGATATGGAGGGAAGATGG + Intronic
1074670457 10:115784742-115784764 GTGAAAACATACAGGGAAGAAGG - Intronic
1075192003 10:120317689-120317711 GTATAAGCATCCAGGGAAGCAGG + Intergenic
1075955687 10:126520850-126520872 GGAGGCACATTCAGGGAAGATGG - Intronic
1077802526 11:5555231-5555253 GTAAAGTCCTTCAGGTAAGAAGG + Intronic
1081118175 11:39231765-39231787 GTTTAGACTTTCTGGCAAGATGG + Intergenic
1081541890 11:44040568-44040590 GTAAACACATTCAGTGAGGAGGG + Intergenic
1081685593 11:45040918-45040940 GTAGAGGCATGCAGGGAAAAGGG + Intergenic
1081931305 11:46873334-46873356 GAAGAGAGATCCAGGGAAGAAGG - Intronic
1083304238 11:61754438-61754460 TTTGAGACCTTCAGGGAAGAGGG + Intronic
1084490030 11:69473176-69473198 GTATAGACAAACTGGCAAGATGG + Intergenic
1084749333 11:71193831-71193853 GTATAGAGACACAGGGAAAATGG - Intronic
1085794799 11:79529217-79529239 GAAGAGACATTCAGGGAAGTGGG - Intergenic
1086092166 11:83015715-83015737 ATTTAGAGATTGAGGGAAGAAGG + Intronic
1088909358 11:114179187-114179209 ATACACAGATTCAGGGAAGAGGG - Intronic
1090541736 11:127713331-127713353 CTATAGACATCCAGGGAGGCTGG + Intergenic
1091317739 11:134626341-134626363 GTGTAGACATTCAGGGGACAGGG - Intergenic
1093183712 12:15995902-15995924 TTTTAGACATTGTGGGAAGATGG + Intronic
1095409079 12:41902669-41902691 ACAGAGACATACAGGGAAGAAGG - Intergenic
1097736346 12:63185805-63185827 GTAAAGACATCCAGGTGAGATGG + Intergenic
1098115756 12:67174858-67174880 GTATTTACATTAATGGAAGAGGG + Intergenic
1099268324 12:80477514-80477536 GTTTAGAAATTTAGGCAAGATGG + Intronic
1102435745 12:112921931-112921953 GAATATACATTCAGGGGACAGGG + Intronic
1103845935 12:123902149-123902171 GTGCAGACACACAGGGAAGAGGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105583933 13:21726506-21726528 CTGTAGACATTCAGAGAACAGGG + Intergenic
1105665343 13:22549686-22549708 CTACAGATATTCAGGGAAGGTGG - Intergenic
1109906722 13:68852798-68852820 GTATAGAAATTGAGAGTAGAGGG - Intergenic
1110805209 13:79746552-79746574 CTATAAACATTCCAGGAAGAGGG + Intergenic
1114975120 14:28086373-28086395 GTATATGCATAAAGGGAAGAAGG + Intergenic
1115810674 14:37103674-37103696 GTCTAGACAGCAAGGGAAGAAGG - Intronic
1117078782 14:52130244-52130266 GAATAAACATTCAGGAAAGTAGG - Intergenic
1117200792 14:53388054-53388076 GAATAGACAGCCAGGGAAGGAGG - Intergenic
1118457438 14:65957785-65957807 GTGGAGTCATTCTGGGAAGAGGG - Exonic
1118703788 14:68461205-68461227 ATTTAGACTTTCAGGGATGAAGG + Intronic
1120088282 14:80300809-80300831 GTATAGACATTCAGGGAAGATGG + Intronic
1124142533 15:27089343-27089365 GTATAGACACTTTGGGAGGAGGG + Intronic
1124431693 15:29613939-29613961 GGATGGATATTCATGGAAGAAGG - Intergenic
1124933095 15:34143008-34143030 GTATAGAAATTGAAAGAAGAGGG - Intronic
1127001665 15:54515743-54515765 ATTAAGACATTCAGGGAAAAAGG + Intronic
1128969084 15:72090773-72090795 ATATAAACATTTAGGGAAGGTGG - Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1131473910 15:92719875-92719897 ATAAAGTCAATCAGGGAAGATGG + Intronic
1131784229 15:95894219-95894241 GATGAGACATTCAGGGAGGAAGG + Intergenic
1132382829 15:101378685-101378707 GTAGAGAACATCAGGGAAGAGGG - Intronic
1134237983 16:12482742-12482764 ATATAGACATTCAGGCTAGAAGG - Intronic
1135294241 16:21265317-21265339 GGAAAGGCATTCAGGGTAGAGGG - Intronic
1137227302 16:46525293-46525315 TTAAATAAATTCAGGGAAGAAGG - Intergenic
1137877059 16:52006911-52006933 GAACAGACATTCAGAGGAGAGGG - Intronic
1137882531 16:52066516-52066538 TTAAAGACTTTCAAGGAAGAGGG + Intronic
1138212186 16:55172989-55173011 GTGTGGACTTTCAGGGTAGAAGG - Intergenic
1141385285 16:83616934-83616956 GAAAAGGCATTCCGGGAAGAAGG - Intronic
1142700675 17:1658435-1658457 GTGTACACATGCTGGGAAGAAGG - Intronic
1143724346 17:8835214-8835236 GTATGGGCATGCAGGGACGAGGG + Intronic
1143838554 17:9712414-9712436 GCAAAGAGAATCAGGGAAGAGGG + Intronic
1145010455 17:19364918-19364940 CCATAGGCATGCAGGGAAGAGGG - Intronic
1146581557 17:34043117-34043139 GCATTGACTTTTAGGGAAGAAGG + Intronic
1148344434 17:46894191-46894213 GTATTGACATTAAAGGAACAGGG - Intergenic
1148552186 17:48557092-48557114 GAATAGTCATTCCGGGAGGAAGG + Intronic
1149031472 17:52087542-52087564 GAAAAGTTATTCAGGGAAGAAGG - Intronic
1150295163 17:64003485-64003507 GGAAAGAACTTCAGGGAAGAGGG + Intronic
1155214057 18:23627110-23627132 GTTTACACTTTCAGAGAAGACGG + Intronic
1156903526 18:42328351-42328373 ATATAGAAATTCAGAGAAGAAGG + Intergenic
1158010130 18:52719106-52719128 ACACAGACATGCAGGGAAGAAGG - Intronic
1158067541 18:53430344-53430366 TTATGCCCATTCAGGGAAGATGG + Intronic
1159385427 18:67718817-67718839 GCAAAGAGATTCAGGGAGGAAGG - Intergenic
1159697051 18:71573579-71573601 GTACAGAGATTCAGATAAGATGG + Intergenic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1160208589 18:76858081-76858103 GCATAGAGAATCAGGGAGGATGG - Intronic
1161694167 19:5756491-5756513 GTACAAACATTCAGGAAAGCTGG + Intronic
1164123459 19:22288557-22288579 GTGTAGCCTTTCAGGGAAGCAGG + Intronic
1165056536 19:33180276-33180298 GTCAAGACAGTCAGGCAAGAGGG - Intronic
1165991836 19:39819729-39819751 GTATGTATATTCTGGGAAGAAGG - Intergenic
1166976732 19:46609326-46609348 GGAGAGAGACTCAGGGAAGAAGG - Exonic
925518153 2:4708263-4708285 CTACAGACATGCAGGGAAAAAGG + Intergenic
925901422 2:8511868-8511890 GTGCAGACATCCAGGCAAGAGGG - Intergenic
925912043 2:8580442-8580464 GTCTCAACATTCAGGGAAGTGGG + Intergenic
926404344 2:12535465-12535487 ATATAGGCATCCTGGGAAGATGG + Intergenic
927495367 2:23548400-23548422 GAAAAGACAGTGAGGGAAGAGGG - Intronic
929367947 2:41183802-41183824 GTATAGACTTTCAGGGAAAGAGG - Intergenic
930142409 2:47965654-47965676 GTACAGACATTTAGGGAATCTGG - Intergenic
932909983 2:75796075-75796097 GCATAAAGATTCAGGGAAAAAGG + Intergenic
933300207 2:80532345-80532367 GGATTGACATTCAGGGTGGATGG - Intronic
934117444 2:88810810-88810832 GAAAAGACCCTCAGGGAAGAAGG - Intergenic
936459849 2:112705516-112705538 TTAAATACATTTAGGGAAGATGG - Intergenic
937898888 2:127000907-127000929 ATATAGAGACTCAGGAAAGAAGG - Intergenic
941115395 2:161466414-161466436 GTAAAGACATTCTGAGATGAAGG - Intronic
941709155 2:168693539-168693561 GAATGGATATTCAGGGCAGATGG - Intronic
942300920 2:174561586-174561608 ATACAGATATTAAGGGAAGAGGG + Exonic
942482918 2:176407993-176408015 TGATAAACATTCAGAGAAGAGGG + Intergenic
943628122 2:190221548-190221570 GCACAGAAATTCCGGGAAGAGGG + Intronic
944015011 2:195025747-195025769 ACATAGACACACAGGGAAGAAGG + Intergenic
946551507 2:220806584-220806606 GAATAGATATTCATGGAACATGG + Intergenic
947484601 2:230536634-230536656 GTATCTATATTCAGGGAAGCAGG - Intronic
1169045828 20:2533862-2533884 GAATACACATTCAGGCAAGAGGG - Intergenic
1169546121 20:6652778-6652800 GAACAGGCATTCAGGCAAGATGG - Intergenic
1172903278 20:38350384-38350406 GGAAACAGATTCAGGGAAGATGG - Intronic
1173049282 20:39543549-39543571 GTAAAGACATTCCAGGCAGAGGG - Intergenic
1175654953 20:60761843-60761865 GTATCAGCATTCAGGGAAGGAGG + Intergenic
1175774786 20:61646303-61646325 GAATAAACACTCACGGAAGATGG - Intronic
1175926875 20:62475535-62475557 GTCTTGACCTGCAGGGAAGAGGG + Exonic
1181448050 22:22993828-22993850 AAATAACCATTCAGGGAAGAGGG - Intergenic
1182387129 22:29953795-29953817 GAACAGACAAACAGGGAAGAGGG - Intronic
949215217 3:1559296-1559318 GTAGATACATCAAGGGAAGATGG + Intergenic
952519784 3:34145200-34145222 GAATAGACACTCTGAGAAGAGGG + Intergenic
953581116 3:44157520-44157542 GTAGAGCCATCCTGGGAAGAAGG + Intergenic
957185655 3:76938387-76938409 GTAAAGACATACAGAGATGAGGG - Intronic
957265784 3:77963553-77963575 GTATAGACATTCAGCCATGAGGG - Intergenic
957923974 3:86784434-86784456 ATATAAAAATTCAGGGAATATGG - Intergenic
959153552 3:102638100-102638122 GTATAGGCTTTCTGAGAAGAGGG - Intergenic
964105259 3:153032478-153032500 GTATAGACAATAAGTGAATAAGG - Intergenic
964259485 3:154819243-154819265 GTTTAGACATTGAGGAAATAAGG + Intergenic
964646891 3:158968253-158968275 TCATAGATATTTAGGGAAGAAGG - Intronic
966955155 3:184869166-184869188 TTATAGACTTTCAGTTAAGAAGG + Intronic
968280091 3:197470550-197470572 GTAGAGATAATCAGAGAAGATGG - Intergenic
969050727 4:4371003-4371025 GTAATGACATTCTGGCAAGAGGG - Intronic
969057808 4:4413223-4413245 CTATAGACAGACAGGAAAGAGGG + Intronic
969592185 4:8128175-8128197 GCAGAGACACACAGGGAAGACGG - Intronic
970745111 4:19284766-19284788 AAACAGACACTCAGGGAAGAAGG + Intergenic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
975464205 4:74691116-74691138 TTATAGACATGCCAGGAAGAAGG - Intergenic
976447666 4:85150486-85150508 GTATACACTTTCAGGGTAGCTGG + Intergenic
978342983 4:107737316-107737338 GTTTAGTCATTAATGGAAGAAGG + Intergenic
982286025 4:153735908-153735930 ATATAGACAATCATGTAAGATGG + Intronic
982507532 4:156239237-156239259 GTTTAGACCCTCAGGAAAGAAGG - Intergenic
982921769 4:161283808-161283830 ATATACACATACAGGAAAGAGGG - Intergenic
983280609 4:165676648-165676670 GTATAGACACACAGAGTAGAAGG + Intergenic
983531544 4:168814694-168814716 TTATAGACATTCGGGAAAGAGGG - Intronic
989801279 5:45543956-45543978 GTAAAGAGATTAAGAGAAGATGG + Intronic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
993414530 5:87610104-87610126 CTATATACATGCAGGAAAGAAGG + Intergenic
994173420 5:96683171-96683193 GTATGAGCATTCAGGAAAGAGGG + Intronic
995310573 5:110705821-110705843 GTAAAGACATTCAGGAAGAATGG + Intronic
996038759 5:118787444-118787466 GTATATACACTCAGGGCAGTTGG + Intergenic
997619943 5:135281025-135281047 GAATAGACAGTCAGGCTAGAGGG - Intronic
998514837 5:142743550-142743572 GGAGAGGCATTCCGGGAAGAGGG + Intergenic
1001428586 5:171641976-171641998 GTGCAAACAGTCAGGGAAGAGGG + Intergenic
1003486896 6:6587901-6587923 GAATAGAGATACATGGAAGAAGG + Intergenic
1004396971 6:15254089-15254111 ATACAAACATGCAGGGAAGACGG - Intronic
1004463591 6:15862281-15862303 GCAGAGACATTCCAGGAAGAAGG - Intergenic
1008940115 6:57037769-57037791 TCATAGAGATACAGGGAAGAGGG - Intergenic
1010353207 6:74900462-74900484 GTAAATACATTCATGCAAGAGGG - Intergenic
1011287427 6:85739891-85739913 GTAAAAACATTCTGGGCAGATGG + Intergenic
1013802140 6:113959266-113959288 ATGTAGACATTTAGAGAAGAGGG - Intronic
1014079754 6:117272361-117272383 GCAGAGACCTACAGGGAAGAAGG - Intronic
1014377804 6:120698532-120698554 CTATAGAGAATCAGGGATGAAGG - Intergenic
1014654353 6:124080782-124080804 TTATAGAAATACAGGAAAGAAGG - Intronic
1014991300 6:128080406-128080428 ATATAGAAATGCAGTGAAGATGG + Intronic
1018195659 6:161354304-161354326 ATATAGACATGAAGGGAATATGG + Intronic
1018313757 6:162536535-162536557 CTACAGACAAGCAGGGAAGATGG - Intronic
1020092273 7:5348421-5348443 GGATAGACAGACGGGGAAGACGG + Intronic
1020426715 7:8074940-8074962 GGATAGACATGGAGGGGAGAGGG + Intronic
1020628681 7:10614607-10614629 CTATTGACATACAGGAAAGATGG - Intergenic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1021766588 7:23955992-23956014 TTATAGTCATTTGGGGAAGATGG + Intergenic
1022534341 7:31086487-31086509 GTATCTCCTTTCAGGGAAGAAGG - Exonic
1022755241 7:33280532-33280554 TGATAGAAATTCAGAGAAGAGGG - Intronic
1023887795 7:44373613-44373635 ATAGGGACATTCAGGGCAGAGGG - Intergenic
1027605904 7:80298250-80298272 GGATAGACATTGAAGAAAGATGG - Intergenic
1028308576 7:89299218-89299240 GAATTGATATTCAAGGAAGATGG + Intronic
1030901134 7:115125261-115125283 ATATATACATTTATGGAAGATGG + Intergenic
1032057417 7:128694992-128695014 GTATAGACCTTAAAGCAAGAAGG - Intergenic
1032652739 7:133896477-133896499 GTATAGACTGTGAGGGCAGAAGG + Intronic
1033066237 7:138157344-138157366 GTAGAGAGATTCAGGGAAACAGG + Intergenic
1033937081 7:146599493-146599515 GTATAGACATAAAAGGAGGAAGG - Intronic
1037923498 8:22826068-22826090 GTATAGACTTTCAGTCATGAAGG + Intronic
1040903495 8:52441166-52441188 GCAAAGCCATGCAGGGAAGAGGG + Intronic
1042892472 8:73627445-73627467 GTATTCACAAACAGGGAAGAAGG - Intronic
1043327116 8:79066052-79066074 GTTTAGACAATAAGGGAACATGG + Intergenic
1045085169 8:98675433-98675455 TTATAGACATACAGATAAGATGG - Intronic
1046013363 8:108576739-108576761 ATATGGACATTCACAGAAGAGGG + Intergenic
1046325698 8:112641935-112641957 GTATAGACATTTTGGAAAGAAGG + Intronic
1046806940 8:118489037-118489059 ATATAGACATTCTGGGGAGGAGG + Intronic
1046844687 8:118902766-118902788 GGACAGACATGCAGGGAGGAAGG - Intergenic
1047163836 8:122413863-122413885 GTAATGACATTGAGGTAAGAAGG + Intergenic
1047204843 8:122794834-122794856 GGATAGTCTTTCTGGGAAGAAGG - Intronic
1047864810 8:129011122-129011144 GTTTAGAAATTAAGGGAAAAAGG + Intergenic
1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG + Intronic
1048553159 8:135452704-135452726 GTATAGATTTGCAGGGCAGATGG + Intergenic
1055437876 9:76310635-76310657 ACCTAGAAATTCAGGGAAGAGGG - Exonic
1055710450 9:79055131-79055153 AGATAGACACTGAGGGAAGATGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057236215 9:93363769-93363791 GACTAGACATTTAGGGAAAAAGG - Intergenic
1058503151 9:105642959-105642981 GTAGAGACATAGAGAGAAGATGG + Intergenic
1060148335 9:121270111-121270133 GAAAAGACATTCTGGGAAGCAGG + Intronic
1060689177 9:125641212-125641234 GTATAGGCACTAAGGGAAGGAGG - Intronic
1186846433 X:13535359-13535381 AGCTAGACATTCAGGAAAGAAGG - Intergenic
1188029914 X:25252801-25252823 GAGGAGACATACAGGGAAGAAGG + Intergenic
1190594980 X:52043421-52043443 GCAATGACATTCTGGGAAGAAGG - Intergenic
1190613844 X:52210652-52210674 GCAATGACATTCTGGGAAGAAGG + Intergenic
1192185332 X:68942900-68942922 GAAAGGTCATTCAGGGAAGAGGG + Intergenic
1192435013 X:71137711-71137733 GTATAGCCCTGGAGGGAAGAAGG - Exonic
1192862481 X:75091168-75091190 GTATCTATATTCAGGAAAGAGGG - Intronic
1195548187 X:106137372-106137394 CTCAAGACATACAGGGAAGAAGG - Intergenic
1197652675 X:129082768-129082790 GGAGAGACAGTCGGGGAAGAGGG + Intergenic