ID: 1120091543

View in Genome Browser
Species Human (GRCh38)
Location 14:80337901-80337923
Sequence CTTTCACCACACCTGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120091540_1120091543 11 Left 1120091540 14:80337867-80337889 CCTTAAAATTGGGCTCTTTGTCA 0: 1
1: 0
2: 2
3: 8
4: 166
Right 1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG 0: 1
1: 0
2: 1
3: 36
4: 243
1120091536_1120091543 30 Left 1120091536 14:80337848-80337870 CCTTGACCTGAACTGATCTCCTT 0: 1
1: 0
2: 1
3: 40
4: 473
Right 1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG 0: 1
1: 0
2: 1
3: 36
4: 243
1120091537_1120091543 24 Left 1120091537 14:80337854-80337876 CCTGAACTGATCTCCTTAAAATT 0: 1
1: 0
2: 0
3: 14
4: 202
Right 1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG 0: 1
1: 0
2: 1
3: 36
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120091543 Original CRISPR CTTTCACCACACCTGGCACA GGG Intronic
900178396 1:1300700-1300722 CTCTCACCCCACCTGGCACTTGG - Intronic
901006140 1:6172472-6172494 CAACCACCACACCTGGCTCAGGG + Intronic
901164519 1:7208474-7208496 CTTTCACATCACCTAGCACAGGG - Intronic
903183365 1:21616401-21616423 CTAGAACCACACCTGGCACATGG - Intronic
903228001 1:21904657-21904679 CCTTGGCCACACCTGGCACATGG - Intronic
903646266 1:24897994-24898016 CCTACTCCACACCTGGCACACGG + Intergenic
903740759 1:25557112-25557134 GCATCACCAGACCTGGCACAGGG - Intronic
904286365 1:29455324-29455346 CTCTGTCCAGACCTGGCACATGG + Intergenic
905010162 1:34741831-34741853 CCTTCACCCCACCTGGCTCCAGG - Intronic
905196111 1:36278637-36278659 GATCCACCACGCCTGGCACAAGG - Intronic
906513018 1:46422319-46422341 TTTTCAAAACACCTGGCACATGG - Intergenic
911042421 1:93601140-93601162 CTGGCACTATACCTGGCACATGG + Intronic
912451171 1:109768610-109768632 CTTTCCCCAGCCCTGGCACAGGG + Intronic
913126195 1:115792678-115792700 CTTTTGCCATGCCTGGCACATGG + Intergenic
913375008 1:118141571-118141593 CTTGCTCTACACCTGGCAGAAGG - Intronic
916552611 1:165863123-165863145 TCTTCAGCACACCTGGCACCTGG - Intronic
916844103 1:168630799-168630821 CTTTCTCCTCACCTCGCAGAAGG + Intergenic
917690322 1:177461910-177461932 ATTTCACTACACCTTTCACAAGG + Intergenic
917750311 1:178047324-178047346 CTACCACCACTCCTGGAACATGG + Intergenic
920566995 1:206982081-206982103 CTTTCCCCACAGCTGCCAAAAGG + Intergenic
920834095 1:209491890-209491912 CTTTCACAACCCCTCCCACATGG - Intergenic
921778361 1:219129675-219129697 CTTCCAGCATATCTGGCACATGG - Intergenic
922282380 1:224138376-224138398 CATTTACCACACATTGCACACGG - Intronic
922715682 1:227870006-227870028 CACTCACCACAGCTGGCACAGGG - Intergenic
922756553 1:228100191-228100213 CTTTGACCTCACCTGTCGCAGGG + Intergenic
1062842857 10:684689-684711 TTTTCAGGACACTTGGCACAAGG - Intronic
1064725971 10:18280183-18280205 GTTTCACCATAGCTGACACATGG + Intronic
1065477241 10:26153104-26153126 CTCTCACCCCACCAAGCACAAGG - Intronic
1069916723 10:71791121-71791143 CGGTCACCACACCTGGCACCCGG - Intronic
1071342504 10:84661852-84661874 CTTTCACCACACATTGCATTTGG - Intergenic
1071719578 10:88130061-88130083 CTAAAACCACAACTGGCACATGG - Intergenic
1072547390 10:96450066-96450088 CCAGCACCAGACCTGGCACATGG + Intronic
1072901456 10:99411074-99411096 CTCTCACGGCATCTGGCACATGG + Intronic
1073100553 10:101004156-101004178 CTCTGACCACACCTGGCACATGG - Exonic
1073259470 10:102178050-102178072 CTCTCACCTCACCTGTCCCAAGG - Intergenic
1073400098 10:103250481-103250503 CTTTCTGCTAACCTGGCACATGG - Intergenic
1074389402 10:113044558-113044580 CTTTGAGGGCACCTGGCACAGGG - Intronic
1074848983 10:117423621-117423643 CTCTCATCAGACCTGGCATATGG - Intergenic
1075073453 10:119334388-119334410 TTTTCAACAGAACTGGCACAGGG + Intronic
1075485843 10:122821431-122821453 CTGTCACCATAGCTTGCACATGG - Intergenic
1075639802 10:124056525-124056547 CTGTCCCCACACTTGGCACCAGG - Intronic
1076427544 10:130378522-130378544 CTTGCACAGCATCTGGCACAGGG - Intergenic
1076983037 11:215270-215292 GTCCCACCACACCTAGCACATGG - Intergenic
1077448468 11:2617228-2617250 CTTCCCCCACACCTTGCCCATGG + Intronic
1078018060 11:7632374-7632396 CTTGCTCCAGACCTGGCACAGGG + Intronic
1078977555 11:16495560-16495582 CTTGAACCACAGGTGGCACATGG - Intronic
1084304962 11:68276283-68276305 TTTTCCCCACTCCAGGCACATGG + Intergenic
1088720245 11:112585787-112585809 CTAGCATCATACCTGGCACATGG - Intergenic
1090284545 11:125488394-125488416 GAGTCACCACACCTGGCCCATGG - Intronic
1090466800 11:126942284-126942306 CTAGCATCACGCCTGGCACACGG + Intronic
1092214314 12:6670141-6670163 GAGTCACCGCACCTGGCACAGGG - Intronic
1096620237 12:52860023-52860045 CTTTCTTCACCCCTGGCCCATGG - Intergenic
1098239584 12:68453228-68453250 CCCTCTCCACTCCTGGCACATGG - Intergenic
1098987399 12:77027481-77027503 CTTACTCCAGACCTGGCACTTGG + Intronic
1100644609 12:96515741-96515763 CTTTCACAGGACCTAGCACATGG - Intronic
1100679362 12:96901831-96901853 GAGTCACCACACCTGGCCCATGG + Intergenic
1101197773 12:102403267-102403289 CTTACAATAGACCTGGCACATGG + Intronic
1102364357 12:112319041-112319063 CTTTCACCAAACTTGGCACCAGG - Intronic
1103204075 12:119114609-119114631 CTGTCACAGTACCTGGCACATGG + Intronic
1104396638 12:128439653-128439675 CTTTCAGCACACCCTACACAAGG + Intronic
1106821805 13:33473128-33473150 CTAACACCATGCCTGGCACATGG - Intergenic
1107603516 13:42037645-42037667 CTTTAACCTCACATGGCAGAAGG + Intergenic
1108530660 13:51324435-51324457 CTAGCACCATGCCTGGCACATGG + Intergenic
1108890864 13:55257471-55257493 ATTTTACCTCCCCTGGCACATGG - Intergenic
1110677076 13:78261448-78261470 CTTTAACCTCACATGGCAGAAGG - Intergenic
1111113593 13:83748053-83748075 CTTTCCCCACCCCAGGCTCATGG - Intergenic
1113093211 13:106636448-106636470 CTTTCTCCAAATCTGTCACATGG + Intergenic
1113816891 13:113178195-113178217 CTTTCAACACACCGTGGACAGGG + Exonic
1113875785 13:113593688-113593710 CGTACACCACACCTGTCACCTGG - Intronic
1113875864 13:113594084-113594106 CGTACACCACACCTGTCACCTGG - Intronic
1113875899 13:113594242-113594264 CGTACACCACACCTGTCACCTGG - Intronic
1114934925 14:27522666-27522688 CTTTCACCACACCCAGAAAAGGG - Intergenic
1115614253 14:35078258-35078280 CTTTCACAGTACCTGGCACATGG + Intronic
1115774922 14:36704767-36704789 CTTTCCCCACCCCTGTCATATGG + Intronic
1118656585 14:67956997-67957019 CTATCACAACACCTGGCATATGG - Intronic
1119032007 14:71200123-71200145 CTTGCACTCCACCTGGCACATGG - Intergenic
1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG + Intronic
1121220613 14:92282285-92282307 CCTACTCCACACCTAGCACAAGG + Intergenic
1125263034 15:37849123-37849145 CTTTCACAACATCTTGCAGAGGG + Intergenic
1125876506 15:43151542-43151564 CTTGAACAACACCTGGTACACGG - Intronic
1126041381 15:44594459-44594481 CAGTCACCACACCTGGCCCAGGG - Intronic
1126378355 15:48019399-48019421 CTTGCGCGGCACCTGGCACATGG - Intergenic
1127719520 15:61686135-61686157 CTCTCACTATTCCTGGCACACGG - Intergenic
1128702436 15:69814076-69814098 CTTTCCCCACACCTGCCTAAGGG - Intergenic
1129889716 15:79063893-79063915 CTTTCCCCTCTCCTGGCCCAGGG + Intronic
1131123231 15:89836253-89836275 CTCTCACAGTACCTGGCACATGG + Intronic
1131545028 15:93308736-93308758 CTTTCCCCAAGACTGGCACATGG + Intergenic
1131648401 15:94371836-94371858 CTGCCACCACACCTGGCTAAGGG + Intronic
1133718327 16:8470529-8470551 CTTTCAGTACACCAGGCACTGGG - Intergenic
1133885757 16:9826075-9826097 CTCACACCATGCCTGGCACATGG - Intronic
1133917764 16:10124707-10124729 CTTGTACAACACCTGACACACGG - Intronic
1137724165 16:50645943-50645965 CTTTCCCCTCTCCTGGCAGAGGG - Intergenic
1138298919 16:55910289-55910311 CTTACCCCACACCTGACAGAAGG + Intronic
1140197110 16:72864321-72864343 CTTTGAAGATACCTGGCACATGG + Intronic
1140537889 16:75727502-75727524 CTTTAACCTCACATGGCAGAAGG - Intronic
1142612472 17:1116790-1116812 CTAGCACAGCACCTGGCACACGG + Intronic
1142629794 17:1217467-1217489 CTTGAACCAGACCTGACACATGG - Intronic
1143311199 17:5990771-5990793 CAATCACCACGCCTGGAACATGG + Intronic
1143704251 17:8686160-8686182 TTTTCACCCCACCTGGCCAAGGG + Intergenic
1144584722 17:16481280-16481302 CTCTCATCTCACCTGGCACCAGG - Intronic
1145789795 17:27619205-27619227 CCATCACCACACCTGGCGCCAGG - Intronic
1146468270 17:33104349-33104371 CTTTCACCACCCCAGGAAAAGGG + Intronic
1146935796 17:36811922-36811944 CTTGCACCAAGCCTAGCACAAGG + Intergenic
1147274963 17:39308260-39308282 GTGTCACCACACCTGGCCCATGG + Intronic
1149578105 17:57728145-57728167 CTATCCCCAGACCTGGCGCATGG - Intergenic
1149972354 17:61231726-61231748 GTGTCACCACACCTGGCTAATGG - Intronic
1150669830 17:67183228-67183250 CTTTCACCCAAACTGCCACATGG + Intronic
1151434136 17:74083647-74083669 TTAACACCATACCTGGCACATGG + Intergenic
1151592232 17:75053003-75053025 CCTCCAGCACACCTGGAACAAGG - Exonic
1151786192 17:76276176-76276198 CTCACCCCACACCTGGCACAGGG - Intronic
1152715990 17:81901029-81901051 CTTGCTCCTCACCTTGCACATGG - Intronic
1153656869 18:7290624-7290646 CTAACACCATACCAGGCACATGG + Intergenic
1153776319 18:8457197-8457219 ATTTCTCCACATCTGGCAGAGGG + Intergenic
1153833442 18:8943358-8943380 CTCTCACCACACCAGGGAAAGGG + Intergenic
1154142664 18:11838677-11838699 CTGTCACCATGCGTGGCACATGG - Intronic
1155841368 18:30647876-30647898 CTACCCCTACACCTGGCACATGG + Intergenic
1158022600 18:52860854-52860876 ATGTCACCACACCTGGCACCTGG - Intronic
1158540936 18:58353885-58353907 CTTCCAGCATACCTGGCACGTGG + Intronic
1164365726 19:27579799-27579821 GTTTCACCACACCTACCAAAGGG - Intergenic
1164378663 19:27712162-27712184 GTTTCACCACACCTACCAAAGGG + Intergenic
1167825279 19:51967274-51967296 CCAGCACCATACCTGGCACACGG - Intronic
924991905 2:319648-319670 CACTCCCCACACCTGCCACAGGG + Intergenic
926146802 2:10401239-10401261 CCAGCACCACACCAGGCACAGGG + Intronic
926197841 2:10774470-10774492 CCGTCACCACAGCTGGCACAGGG - Intronic
926645750 2:15288200-15288222 CTAGCACAATACCTGGCACAGGG - Intronic
927228271 2:20792615-20792637 CTTGCACAAAACTTGGCACATGG + Intronic
929048853 2:37816944-37816966 CTTTGGCCACACGTGGCCCATGG + Intergenic
930418959 2:51125547-51125569 CTAACACCACACCTGGTCCAGGG - Intergenic
931208712 2:60172056-60172078 CTTGCACTACATCTGGAACATGG + Intergenic
932180005 2:69638415-69638437 CTTTCCCCACAATTGGCACGGGG + Intronic
936239431 2:110774142-110774164 GAATCACCTCACCTGGCACACGG - Intronic
937081770 2:119145323-119145345 CAAACACCACACATGGCACATGG + Intergenic
943083541 2:183284580-183284602 CTTTGTCCTCACCTGGCAGATGG - Intergenic
945683392 2:212939582-212939604 CTGGCACCTTACCTGGCACATGG + Intergenic
947550408 2:231041525-231041547 TCATCCCCACACCTGGCACATGG - Intronic
948335002 2:237200804-237200826 CTCTCACCACTCCCGGCACCTGG - Intergenic
948537657 2:238658167-238658189 TTTGCAGGACACCTGGCACATGG + Intergenic
948847128 2:240688433-240688455 CTGTTCCCACACCTGGCTCAAGG + Intergenic
1169111147 20:3034939-3034961 CTTGCACAATGCCTGGCACATGG - Intronic
1170573022 20:17642978-17643000 CATTCAGGACACCTGGCACAAGG - Exonic
1172744899 20:37199341-37199363 CTTGCAGAGCACCTGGCACACGG - Intronic
1173148492 20:40545761-40545783 CTTTGTCCTCACCTGGCTCAGGG - Intergenic
1173835086 20:46119487-46119509 CTTTCTCCACTCCTACCACAAGG - Intronic
1174185360 20:48702502-48702524 ATGTGACCACACCTGGCACAAGG - Intronic
1174394387 20:50237657-50237679 CTTTGGCCACACCGGGGACAGGG - Intergenic
1174994238 20:55547513-55547535 GTTTTCCAACACCTGGCACAGGG - Intergenic
1175176000 20:57112482-57112504 CTCATACCACACCTGGAACATGG - Intergenic
1175250411 20:57606189-57606211 CTTTCTCCACACTAGCCACAAGG - Intronic
1176162881 20:63657511-63657533 CCTTCACCACAACAGGCACATGG + Intergenic
1177670854 21:24224623-24224645 ATTGCACCACAACTGGAACATGG - Intergenic
1178778831 21:35579909-35579931 CTTGCACCATGCCAGGCACATGG - Intronic
1179158974 21:38876334-38876356 CTTTGAACACACCTGCAACAAGG - Intergenic
1179726099 21:43341922-43341944 GTGCCACCACACATGGCACATGG - Intergenic
1181822347 22:25485931-25485953 CTGTCACAAAACCTGGCACATGG + Intergenic
1182611326 22:31550079-31550101 GTGCCACCACACCCGGCACACGG + Intronic
1183291455 22:37004205-37004227 CACTCATCACCCCTGGCACAGGG + Intronic
1183935923 22:41262206-41262228 CTGGCACCACACCAGGGACAGGG - Intronic
1184787605 22:46679330-46679352 CTTCGGCCACACCTGGCACGTGG - Exonic
1184875148 22:47269663-47269685 CTCCCACCACAACTGGGACACGG - Intergenic
1185332490 22:50257998-50258020 CTCTCTCCACGCCTGGCACCTGG - Intronic
950079430 3:10210600-10210622 GTGACACCACACCTGGGACATGG - Intronic
955512546 3:59695921-59695943 GTATCAGCACACCTGGCTCATGG - Intergenic
956216235 3:66852335-66852357 CTTTCTCCTCAACTTGCACATGG - Intergenic
956259181 3:67318442-67318464 CTCTCACCACCCCTGACACCTGG + Intergenic
956531534 3:70224911-70224933 GTTTCACCACACTTTGCAAAAGG - Intergenic
958432819 3:94062402-94062424 TTTTCCCCAGACCTGGCCCATGG - Intronic
961603135 3:128076040-128076062 CTCTCTGCACACCTGGCACACGG + Intronic
961783625 3:129336406-129336428 CCTCCACCCCACCTGGCCCAGGG + Intergenic
962169499 3:133086101-133086123 CTTTCACCACTCCTTGGACAAGG - Intronic
964472865 3:157072624-157072646 TGTGCACCACACCTGGCTCAGGG + Intergenic
966118223 3:176490521-176490543 CGTTCACCTCACCTGAAACATGG - Intergenic
968544725 4:1192959-1192981 CTGCCACCTCATCTGGCACAGGG + Intronic
969514484 4:7638804-7638826 CTTTCTGCACACCAGTCACAAGG + Intronic
969755255 4:9145321-9145343 CTATCCCCACACCTGGCCCCTGG - Intergenic
969863076 4:10052894-10052916 ATGTCACCATACCTGGCAAAGGG + Intronic
970084622 4:12332963-12332985 CTTGCACCTCAGCTGGCAGATGG - Intergenic
970223651 4:13835399-13835421 CTTTCAACAGAACTGGCCCATGG + Intergenic
971522447 4:27571040-27571062 CTTTTACCACAACTGGGAAAGGG + Intergenic
972007146 4:34123801-34123823 CTCTCACTAATCCTGGCACATGG - Intergenic
973140345 4:46760032-46760054 CTTTCACCAGCCCTGGGACCAGG + Intronic
973822863 4:54678159-54678181 CTATCAACACTCCTGGCAGATGG - Intronic
974255022 4:59441538-59441560 CTTTCCCCACCCTTGACACATGG - Intergenic
974888527 4:67850948-67850970 CTTTTTCCTCACCTGCCACATGG - Intronic
975402403 4:73953068-73953090 ATTTCTCCACACCTGCCAAAGGG + Intergenic
976245087 4:82999474-82999496 CTTTGGCCACACCTGGCCAAAGG - Intronic
979108491 4:116718864-116718886 CTGTCACTGCCCCTGGCACAAGG + Intergenic
980626939 4:135385866-135385888 GTTGCAGCACACCTGGTACAGGG - Intergenic
981034654 4:140156879-140156901 CTTTCCCCACATCTGGGGCATGG - Intergenic
982645509 4:158020017-158020039 CTATCACAATACCTGACACACGG + Intergenic
983278694 4:165652566-165652588 CTATAACCTCACATGGCACACGG - Intergenic
983300254 4:165916035-165916057 CTTTCACCAAACATGAAACAAGG - Intronic
984947471 4:184981218-184981240 CTTTCAGGAATCCTGGCACATGG + Intergenic
986294647 5:6427692-6427714 TTACCACCACACCTGGCATAGGG + Intergenic
989317954 5:40104061-40104083 GTTTCACCACACCTACCAAAGGG - Intergenic
989764782 5:45069120-45069142 CTATCACCACACCTTGAACATGG - Intergenic
991469502 5:66952995-66953017 GTATCACCACACCTAGAACAGGG + Intronic
992978609 5:82142160-82142182 ATAACACCACACCTGGCACCTGG - Intronic
993143252 5:84061086-84061108 CTTGCACAATGCCTGGCACATGG - Intronic
994683708 5:102922923-102922945 CTTTTAGCACACTTGGCACAAGG + Intronic
995061421 5:107815065-107815087 CTGCCACCAGACCTGCCACATGG - Intergenic
998788034 5:145733826-145733848 CTTTTACCTCACATGGCAGAAGG + Intronic
998788397 5:145737899-145737921 CTTACACCCCACCTGGCAGAAGG + Intronic
999241038 5:150127462-150127484 CTAAAACCACACCTGGCACATGG + Intronic
999786604 5:154896238-154896260 CTCTTACCACACTTGGAACACGG - Exonic
1001003642 5:168030657-168030679 CTAGCACAACACCAGGCACAGGG + Intronic
1001956893 5:175853911-175853933 CTTACAGCACCCCTGGCCCATGG + Intronic
1001971294 5:175956928-175956950 CTAGCACAGCACCTGGCACAAGG - Intronic
1002129453 5:177071249-177071271 CGTGCACCACACCTGGCTTAGGG - Intronic
1002181844 5:177434796-177434818 CTTGCTCCACACCTGGCCCCCGG + Intronic
1002246148 5:177886849-177886871 CTAGCACAGCACCTGGCACAAGG + Intergenic
1002571816 5:180143912-180143934 CTTCTGCCACACCTGGCCCAGGG - Intronic
1002581333 5:180211060-180211082 CTTTCCCCACACCTGACCCTTGG - Intergenic
1002820975 6:724362-724384 CTTTCATGTCCCCTGGCACATGG - Intergenic
1003168148 6:3699391-3699413 CTTTAACAACACCTGGTACAAGG - Intergenic
1004191698 6:13469876-13469898 CTCACACCAAATCTGGCACATGG + Intronic
1005010500 6:21331089-21331111 CTAGCACAAAACCTGGCACAAGG + Intergenic
1005759032 6:28950711-28950733 CCTTAAGAACACCTGGCACACGG - Intergenic
1006046849 6:31306162-31306184 GTTTCATCACACCTGGAATAAGG - Intronic
1006193561 6:32223654-32223676 CAGTCACCACCCCTGGCACCAGG + Intronic
1007964832 6:45994660-45994682 CTTTCACCACTCATGAGACATGG - Intronic
1008061117 6:46998101-46998123 CTTCCACCCCACCTTGGACACGG + Exonic
1010141628 6:72620964-72620986 CTTCCACCACCCCTGGCACCCGG - Intergenic
1012198522 6:96375716-96375738 TCTTCACAATACCTGGCACATGG + Intergenic
1013420513 6:109962549-109962571 CTCCCTCCACTCCTGGCACATGG - Intergenic
1016511726 6:144850196-144850218 CTTTCAGCATACCTGGGAAAAGG + Intronic
1018849070 6:167574836-167574858 CTTTCCTCTCGCCTGGCACAGGG - Intergenic
1018927298 6:168215242-168215264 CTTTCTCCACCCCTGCCAGAGGG + Intergenic
1019503521 7:1377699-1377721 CTATCACCTGACCTGGCAAAGGG - Intergenic
1020029724 7:4924419-4924441 ATCTCAGCACACCTGGCACAGGG - Intronic
1020426360 7:8070607-8070629 CTGGCACTACTCCTGGCACATGG - Intronic
1023357461 7:39381568-39381590 CTTTTTCCACCCCAGGCACAAGG + Intronic
1024054087 7:45648437-45648459 CTTTCCCCATACCTCGCTCATGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024546855 7:50529597-50529619 CTCTCACAATACCTGGCGCAGGG - Intronic
1026579558 7:71602641-71602663 CTGTCACCTCCCCTGCCACATGG - Intronic
1026990538 7:74582715-74582737 CTTTCCCCATACCTGGCCCTGGG + Intronic
1027686160 7:81280753-81280775 CTTTTACCTCAACTTGCACATGG + Intergenic
1028473457 7:91229213-91229235 CATTCACCACACATGGCAATAGG - Intergenic
1029386547 7:100247315-100247337 CTTTCACCCCACCAGGCTGAGGG - Intronic
1029696700 7:102218253-102218275 GTACCCCCACACCTGGCACATGG + Intronic
1032498147 7:132378342-132378364 TTCTCACCACCCCTGGCACATGG + Intronic
1033948207 7:146749027-146749049 CTTTCATAATACCTGACACATGG - Intronic
1035718712 8:1774110-1774132 CTGTCCCCACACCTGGCTCCAGG - Intronic
1035912176 8:3579638-3579660 CCTTCACCACACCTGGTTCCAGG + Intronic
1037813490 8:22099922-22099944 CTCTCACCACCCCTGCCAGAGGG + Intronic
1038413457 8:27375884-27375906 CATTCCCCTCACCAGGCACACGG + Intronic
1040488443 8:47896715-47896737 CACTCTCCACACATGGCACAGGG + Intronic
1042741845 8:72057580-72057602 AATTCACAACACCTGGCCCAGGG + Intronic
1042964893 8:74339765-74339787 CTTTCAGGACAACTGGCTCAGGG + Intronic
1047348375 8:124050098-124050120 CAATCACCACACCGGACACATGG - Intronic
1047575570 8:126150242-126150264 CAGTCACCACACCTGGGGCAGGG + Intergenic
1047765567 8:127987256-127987278 CTGTCAGCGCACCTGGCAGACGG + Intergenic
1048054766 8:130852883-130852905 CTTCCATGACACCTGGCATAGGG + Intronic
1048207368 8:132426150-132426172 CTTACACCACAACTGGGATAGGG - Intronic
1049434129 8:142578528-142578550 CCGTCACCACACCCGGAACAAGG + Intergenic
1049476611 8:142799858-142799880 CTCTGGCCACACCTGACACAGGG - Intergenic
1050097943 9:2087048-2087070 CTTTCACCAGTCATGGCAAATGG - Exonic
1051502048 9:17788637-17788659 CTTGCACCATACCTGGTAGATGG - Intronic
1051677504 9:19573037-19573059 GTTTCACCACACCTGGTATATGG + Intronic
1053023934 9:34715244-34715266 CTCTCACCACCCCTGCCACCAGG - Intergenic
1053830116 9:42070439-42070461 CTGACACCACACCTGGCAGCAGG + Intronic
1054600442 9:67117013-67117035 CTGACACCACACCTGGCAGCAGG - Intergenic
1056959637 9:91111784-91111806 TTTGCACCACACTTGGCACTTGG - Intergenic
1057582690 9:96301729-96301751 CTGTCACCACACCTGGCTAATGG - Intronic
1059436740 9:114281706-114281728 CTCTTACCACCCCTGGCTCATGG - Intronic
1059859160 9:118438589-118438611 CTCCCACCATGCCTGGCACAGGG - Intergenic
1061889850 9:133612950-133612972 CTTGCAGCACAGCTGGCACCCGG + Intergenic
1062042616 9:134411121-134411143 CTGTCATCACACCTGGCCCTCGG + Intronic
1062373717 9:136252804-136252826 CTCTCTCCACACCTGGGAGATGG + Intergenic
1186258354 X:7747307-7747329 CTTTCCCCCTACCTGGGACAAGG + Intergenic
1186455493 X:9707228-9707250 CTCTCCCCACCCCTGGCCCAGGG + Intronic
1186592617 X:10947103-10947125 CTGGCACCACAGTTGGCACATGG + Intergenic
1192816559 X:74599610-74599632 CTTTAACCTCACATGGCAAAAGG - Intronic
1194299684 X:92170486-92170508 TTTTCTCCATACCTGGAACAAGG - Intronic
1194545673 X:95230671-95230693 CTTTCCCCCCACCTGGCAACAGG - Intergenic
1197106204 X:122719585-122719607 CTTTCACCACATCCTGCACAGGG - Intergenic
1197823371 X:130563842-130563864 CATTCTCCATACCTGGCAAATGG + Intergenic
1197864111 X:130999765-130999787 CTTGCACAATGCCTGGCACATGG - Intergenic
1198812416 X:140549154-140549176 CTAACACAGCACCTGGCACATGG + Intergenic
1200617328 Y:5395647-5395669 TTTTCTCCATACCTGGAACAAGG - Intronic
1201475919 Y:14380440-14380462 GTTTCACCACACCTACCAAAGGG + Intergenic