ID: 1120093497

View in Genome Browser
Species Human (GRCh38)
Location 14:80361520-80361542
Sequence GTCAATAATGTGTTCACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120093497_1120093500 13 Left 1120093497 14:80361520-80361542 CCTGACGTGAACACATTATTGAC 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1120093500 14:80361556-80361578 AAAGTCATCAAAGTCCCAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120093497 Original CRISPR GTCAATAATGTGTTCACGTC AGG (reversed) Intronic
902775704 1:18673379-18673401 GACAAAAATGTGTTCACTTAAGG - Intronic
909520269 1:76560033-76560055 GTCAAAAATGAGTTCACTTTAGG - Intronic
909782465 1:79563570-79563592 GTCAAAAATGTGTTCACCATAGG - Intergenic
917701326 1:177584582-177584604 GTGAATAATGTGTTCACTGGTGG - Intergenic
919147398 1:193652850-193652872 GTCAATGATGTGTTCCCTTGAGG + Intergenic
924558440 1:245137282-245137304 GTCAAAAATGAGTTCACTTTAGG + Intergenic
1064521186 10:16203238-16203260 GTCAAAAATGAGTTCACTGCAGG + Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1069596364 10:69674082-69674104 GTCAATAAAGTGTTCTCCTTTGG - Intergenic
1073802246 10:107054799-107054821 GTAAATAATTTGTTCACGTCAGG - Intronic
1074036091 10:109740207-109740229 GACAATAACAGGTTCACGTCAGG - Intergenic
1079166459 11:18048373-18048395 GTCAATAATGAGTTCACTGTAGG - Intergenic
1082845311 11:57720209-57720231 GTCACTAATGGGTTCATGTCAGG + Intronic
1086092268 11:83016882-83016904 GTCATTTATGTGTGCACATCTGG + Intronic
1086373973 11:86182004-86182026 GTCACTAATGTGTTCACCTGAGG - Intergenic
1093727236 12:22528582-22528604 GTCTATAATATGTTCCCTTCTGG - Intronic
1095664349 12:44778504-44778526 GTCAATTATGTGTACAACTCTGG - Intronic
1100966531 12:100019265-100019287 GTCAATTATGTATTCATCTCAGG + Intergenic
1109049895 13:57466416-57466438 GTCAATGCTGTGTTCTCATCTGG - Intergenic
1109826146 13:67724558-67724580 GTCAAAAATGAGTTCACCTTAGG + Intergenic
1115434744 14:33360001-33360023 GTCAAGAATGTGTTCAGGCTTGG + Intronic
1120093497 14:80361520-80361542 GTCAATAATGTGTTCACGTCAGG - Intronic
1121301271 14:92873340-92873362 GTCAATAATATTTTATCGTCTGG - Intergenic
1121792230 14:96707394-96707416 GTGTATAATGTGTGCACTTCAGG - Intergenic
1125273380 15:37965114-37965136 GTCAACAATGAGTTCACTTTAGG - Intronic
1159774921 18:72592783-72592805 GTCAAAAATGAGTTCACTGCAGG + Intronic
1161398040 19:4055036-4055058 TTCAAGAAGCTGTTCACGTCGGG - Exonic
929772168 2:44901395-44901417 TTGAATAATTTATTCACGTCAGG + Intergenic
930045989 2:47173557-47173579 GTACATAATGTATTCACTTCAGG - Intronic
930618569 2:53620597-53620619 GTCAATATTGTTTTCAAGGCTGG - Intronic
930678126 2:54226444-54226466 TTCAATAATGTGTTGATGTCAGG + Intronic
933263904 2:80160115-80160137 GTCAAAAATGTGTCCATTTCTGG + Intronic
935576075 2:104712025-104712047 GTCAAAAATGAGTTCACTTTAGG + Intergenic
935608010 2:104990182-104990204 CTCAAGAATGTGTTCAAGGCTGG - Intergenic
945713839 2:213333702-213333724 GTCAAAAATGTGTTCACTGTAGG - Intronic
948397011 2:237652310-237652332 GTCAATGATGTGAACACGGCTGG + Intronic
1169617550 20:7466085-7466107 GTCAAAAATGAGTTCACTTTAGG + Intergenic
1170324748 20:15144314-15144336 GACTATAATTTGTTCATGTCAGG + Intronic
1171906609 20:30904743-30904765 GTAAATAATGGGTACACGTACGG - Intergenic
1174523484 20:51153251-51153273 GTCAATAATGTGATTACCTTTGG + Intergenic
1174865651 20:54133134-54133156 GCCAATAATGTGTTGATGTTGGG + Intergenic
957267796 3:77989149-77989171 GTCAAAAATGTGTTCACTGTAGG + Intergenic
960392690 3:117098429-117098451 TTAAAAAATGTATTCACGTCAGG + Intronic
965026535 3:163309258-163309280 GTCAAAAATGTGTTCACTGTAGG - Intergenic
969892530 4:10272980-10273002 GTCTCTAATGTCTTCACGTTTGG + Intergenic
972889226 4:43535176-43535198 GTCAAAGATTTGTTCATGTCAGG - Intergenic
973685784 4:53368165-53368187 GGAAATAATTTGTTCACATCTGG + Intergenic
977845991 4:101767637-101767659 GTCAAAAATGAGTTCACTGCAGG + Intronic
978661511 4:111132560-111132582 GTCAAAAATGAGTTCACCTTAGG + Intergenic
984303735 4:177959388-177959410 GTCAATTATCTGTTGAAGTCAGG - Intronic
998907825 5:146925595-146925617 GACAATGATGTGTTCAAGTGTGG + Intronic
1008279125 6:49574384-49574406 GTTAATAATCTGTTCACGACAGG - Intergenic
1013257123 6:108398739-108398761 GTCAAAAATGTGTTCACTGTAGG + Intronic
1014583444 6:123167016-123167038 GTCAAAAATGAGTTCACAACAGG - Intergenic
1018373210 6:163187188-163187210 GTCAATAATGAGTTCAATTTAGG - Intronic
1024145033 7:46505926-46505948 GTCAAAAATGAGTTCACTACAGG - Intergenic
1028711751 7:93917488-93917510 CTCAATAATGTGTTTACATGAGG + Intergenic
1029314889 7:99702537-99702559 GTCAAAAATGAGTTCACTCCAGG + Intronic
1031116115 7:117670585-117670607 GTCAATTATGTGTTCATTGCAGG - Intronic
1037255883 8:16953023-16953045 GTCAAAAATGAGTTCACTTTAGG - Intergenic
1038509508 8:28118226-28118248 GTTAATAGTCTGTTCACGTTAGG + Intronic
1042852622 8:73231667-73231689 CTCCATGATGTGTTCATGTCAGG + Intergenic
1046913354 8:119653112-119653134 GTCTAGATTGTGTTCACCTCTGG + Intronic
1047469473 8:125155213-125155235 GGCAATAATGTCTTCAGGGCAGG + Intronic
1048254125 8:132892618-132892640 GGCAAAAATGTGCTCACGTGTGG + Intronic
1052420717 9:28240493-28240515 GTCAAAAATGTGTTTACTGCAGG - Intronic
1186214373 X:7283190-7283212 GACAATAATGTGCTCACTTCTGG + Intronic
1188297488 X:28467611-28467633 GTCAATAAAGTCTTCACATGTGG + Intergenic
1191650745 X:63535240-63535262 GTCAAAAATGTGTTCACTGTAGG - Intergenic
1193390649 X:80924109-80924131 GTCAAAAATGAGTTCACATTAGG + Intergenic
1193665816 X:84315192-84315214 GTCAAAAATGAGTTCACTGCAGG - Intergenic
1194107357 X:89787350-89787372 GTCAAGAATGATTTCACGGCCGG - Intergenic
1194588651 X:95769618-95769640 GTCATTCATGTGTTCACTACAGG - Intergenic
1194595782 X:95855568-95855590 GTCAAAAATGAGTTCACTTTAGG - Intergenic
1197419619 X:126222543-126222565 GTCAATAATGACTTCAGGTTTGG - Intergenic
1200459313 Y:3435186-3435208 GTCAAGAATGATTTCACGGCCGG - Intergenic