ID: 1120096479

View in Genome Browser
Species Human (GRCh38)
Location 14:80394490-80394512
Sequence CATCTATTATTGAGAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120096479_1120096484 19 Left 1120096479 14:80394490-80394512 CCTTTGTTTCTCAATAATAGATG No data
Right 1120096484 14:80394532-80394554 CTTATAAAAATTCCCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120096479 Original CRISPR CATCTATTATTGAGAAACAA AGG (reversed) Intergenic
No off target data available for this crispr