ID: 1120097376

View in Genome Browser
Species Human (GRCh38)
Location 14:80403859-80403881
Sequence CAGTGATCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120097376_1120097385 24 Left 1120097376 14:80403859-80403881 CCGTCCACCACTGCTGATCACTG No data
Right 1120097385 14:80403906-80403928 CCATCCCTCTGGATCCAGCAGGG No data
1120097376_1120097383 23 Left 1120097376 14:80403859-80403881 CCGTCCACCACTGCTGATCACTG No data
Right 1120097383 14:80403905-80403927 TCCATCCCTCTGGATCCAGCAGG 0: 14
1: 44
2: 107
3: 135
4: 303
1120097376_1120097381 13 Left 1120097376 14:80403859-80403881 CCGTCCACCACTGCTGATCACTG No data
Right 1120097381 14:80403895-80403917 TCCACTGACTTCCATCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120097376 Original CRISPR CAGTGATCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr