ID: 1120101990

View in Genome Browser
Species Human (GRCh38)
Location 14:80455334-80455356
Sequence CTACTCCTCTAGGTCATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120101990_1120101993 0 Left 1120101990 14:80455334-80455356 CCTTTAATGACCTAGAGGAGTAG No data
Right 1120101993 14:80455357-80455379 ATCCACTTCGCCACCTGGACCGG No data
1120101990_1120101992 -5 Left 1120101990 14:80455334-80455356 CCTTTAATGACCTAGAGGAGTAG No data
Right 1120101992 14:80455352-80455374 AGTAGATCCACTTCGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120101990 Original CRISPR CTACTCCTCTAGGTCATTAA AGG (reversed) Intergenic
No off target data available for this crispr