ID: 1120105139

View in Genome Browser
Species Human (GRCh38)
Location 14:80485478-80485500
Sequence AGTTATACACAATTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120105139_1120105142 30 Left 1120105139 14:80485478-80485500 CCAACCTCAAATTGTGTATAACT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1120105142 14:80485531-80485553 ATATGCATACTGAAACATATAGG 0: 1
1: 0
2: 4
3: 45
4: 392
1120105139_1120105141 -4 Left 1120105139 14:80485478-80485500 CCAACCTCAAATTGTGTATAACT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1120105141 14:80485497-80485519 AACTATTATCATTGCTAATTAGG 0: 1
1: 0
2: 2
3: 25
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120105139 Original CRISPR AGTTATACACAATTTGAGGT TGG (reversed) Intronic
901285874 1:8078484-8078506 AGTTTGACAGAATATGAGGTCGG + Intergenic
902631898 1:17709762-17709784 TGTTTTACACACTTTGAGTTTGG - Intergenic
904853932 1:33481030-33481052 AGTTCTATACAGTGTGAGGTTGG + Intronic
908648218 1:66302893-66302915 AGTTACACACAGATAGAGGTTGG - Intronic
909135143 1:71789115-71789137 AGTTATACACATATGGAGGCTGG + Intronic
909622711 1:77685181-77685203 AGATATATACTATTTGTGGTAGG + Intergenic
912482115 1:109990974-109990996 AGTTATACATAATTAGAAGCAGG - Intronic
917070332 1:171143342-171143364 AGATACATACAGTTTGAGGTAGG + Exonic
917711550 1:177690057-177690079 AGTTACACACAATATGATTTGGG - Intergenic
920676974 1:208044917-208044939 GCTTATACCCAATTTGATGTAGG + Intronic
922860999 1:228816230-228816252 AGTTATACATGCTTTGATGTAGG - Intergenic
923576323 1:235161948-235161970 AGTTAGACAGTATCTGAGGTAGG - Intronic
1065024839 10:21531642-21531664 AGTTTTATCCATTTTGAGGTAGG + Intergenic
1067463354 10:46474769-46474791 AGCTAAGCACAATTTGAGATGGG - Intergenic
1067623840 10:47909869-47909891 AGCTAAGCACAATTTGAGATGGG + Intergenic
1072367411 10:94727209-94727231 AGTTAAAAACCATTTAAGGTGGG + Intronic
1077665927 11:4109177-4109199 TGTTATATACAGTTTGAAGTAGG + Intronic
1079592927 11:22202866-22202888 AGTTATACTGGATTTAAGGTGGG - Intronic
1084818678 11:71667952-71667974 ATTTAGAGACAATTTGCGGTAGG + Intergenic
1086011817 11:82113841-82113863 AGTTATATATTATTTGAAGTAGG - Intergenic
1086445768 11:86868793-86868815 ATTTATACAGAATCTGAGTTGGG - Intronic
1086570734 11:88281342-88281364 AGTTAAAAAGAATTTGAGGATGG + Intergenic
1088763207 11:112951393-112951415 AGCTATTCACAAGTAGAGGTTGG - Intergenic
1094425979 12:30317559-30317581 AGTTAAACACAAATTGAGCCAGG + Intergenic
1094426185 12:30319732-30319754 AGTTAAACACAAATTGAGCCAGG + Intergenic
1095451767 12:42338437-42338459 AGTAATACACCATTTGGTGTTGG + Intronic
1099904723 12:88758683-88758705 GGTTATCCAGAATTTGAGTTGGG - Intergenic
1100913331 12:99390268-99390290 AGTGAAACACAATTTGAAGATGG - Intronic
1102717794 12:114989200-114989222 AAATATACACAATGTGTGGTGGG - Intergenic
1109767491 13:66922802-66922824 AGTTGTATACAAGTTGTGGTTGG - Intronic
1109787783 13:67203736-67203758 ATTTATACATAATTTGTGATAGG - Intronic
1110872792 13:80472039-80472061 AGCTTTACACAATTTTGGGTAGG + Intergenic
1113241214 13:108339747-108339769 AGTTACTAACAATTAGAGGTAGG + Intergenic
1114914588 14:27247141-27247163 AATGATACACAAATTGAGGGCGG + Intergenic
1116751619 14:48893037-48893059 AATTATACAAAATATGAGATTGG + Intergenic
1120105139 14:80485478-80485500 AGTTATACACAATTTGAGGTTGG - Intronic
1120590763 14:86370945-86370967 AGTGCCACACAATTTGGGGTGGG - Intergenic
1124378754 15:29146600-29146622 TGTTATACACTGTGTGAGGTAGG - Intronic
1124503379 15:30250403-30250425 AGGGATACACAATTTCAGTTAGG + Intergenic
1124740176 15:32288236-32288258 AGGGATACACAATTTCAGTTAGG - Intergenic
1127488057 15:59437683-59437705 ACTTCTCCCCAATTTGAGGTGGG + Intronic
1135283356 16:21172031-21172053 ATTTATACACACTTGGAGCTGGG - Intronic
1137321261 16:47385375-47385397 AGTGGTACACAATCTGAAGTTGG + Intronic
1138127617 16:54451958-54451980 AGTGACACAAAATTTGAGGAGGG + Intergenic
1138783725 16:59820865-59820887 AGTTATGCACAATTTGCCTTAGG - Intergenic
1143179810 17:4977475-4977497 AGTTATGAACAATTTGATGTTGG + Intronic
1148243701 17:46016457-46016479 ATTTCTACACAGTGTGAGGTGGG - Intronic
1149121420 17:53171057-53171079 AGGTATTCACTATTTGGGGTAGG - Intergenic
1151144284 17:72026193-72026215 TGTTTTACTCAAATTGAGGTAGG - Intergenic
1151239075 17:72743826-72743848 AGTTATTCACAGTATGAGTTGGG - Intronic
1152411185 17:80124057-80124079 AGTTATTCACAATTTCAAGATGG - Intergenic
1153048676 18:880776-880798 ATTTATGCAGAATTTGAGCTGGG - Intergenic
1155797266 18:30055552-30055574 AGTAACACAAAATTTGAGGTGGG + Intergenic
1156719583 18:40053665-40053687 AGTTGTATACCATATGAGGTAGG + Intergenic
1158035721 18:53027461-53027483 AGTTATACACAATTTCAAACTGG - Intronic
1159142952 18:64419285-64419307 AGATTCACACAATTAGAGGTAGG - Intergenic
1159456878 18:68670233-68670255 ACTAATACACAATATAAGGTAGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165148390 19:33747057-33747079 AGTCATAAATAATTTCAGGTTGG + Intronic
1167810405 19:51824794-51824816 AGTTACAAGCAATGTGAGGTCGG + Exonic
926651333 2:15349655-15349677 AATTAAATACAATTTAAGGTTGG + Intronic
927024564 2:19052437-19052459 AATTATACATAATTTGATATTGG + Intergenic
928653264 2:33423762-33423784 AGTTATACTAGATTTAAGGTGGG - Intergenic
929898191 2:45979560-45979582 AGTTGTACAAAATTGGAGGGTGG + Intronic
932728671 2:74201467-74201489 AGTTACTCACAAGCTGAGGTGGG - Intronic
933146355 2:78858503-78858525 AGTTATACAGATTATGAGATAGG - Intergenic
938366423 2:130738006-130738028 ATTTATACAGAATTTGATATAGG + Intergenic
939998378 2:148941585-148941607 AGTTAAAAACAAATTGAGCTTGG - Intronic
945187214 2:207151374-207151396 AGTTATCCGCAAATTGAGGAGGG + Intronic
1170006171 20:11671675-11671697 ACTTATACACCATTTGAGCTTGG - Intergenic
1170116256 20:12863360-12863382 ACTTATAGACAATCTAAGGTAGG + Intergenic
1176911775 21:14574192-14574214 AATTATGGACAATCTGAGGTGGG - Intronic
1178455389 21:32745294-32745316 AATTATACAGAGTTTGAGGGAGG - Intronic
1181736242 22:24883949-24883971 AATTTTAAAAAATTTGAGGTGGG + Intronic
1184612993 22:45617679-45617701 ATTTGTGCATAATTTGAGGTAGG + Intergenic
949693987 3:6672832-6672854 AGAAATAAACAATTTGAGATGGG - Intergenic
951081836 3:18459992-18460014 AGTTGTAGACAATTTAATGTCGG + Intergenic
951593025 3:24286972-24286994 AGTTAGACAGAAGTTGAAGTTGG + Intronic
952558329 3:34559406-34559428 AATTTTATACAATGTGAGGTGGG + Intergenic
954333102 3:49901222-49901244 ACTTACACCCAATGTGAGGTTGG - Intronic
955091416 3:55754946-55754968 AGTTAAACAAAAGTGGAGGTGGG + Intronic
955236343 3:57143186-57143208 AGTTAAACACACTTTAAGGTAGG - Intronic
957994242 3:87668541-87668563 AATTCTAAACTATTTGAGGTAGG - Intergenic
958574779 3:95934940-95934962 ATTTATTCACACTTTGAGTTTGG - Intergenic
963399503 3:144779666-144779688 AGTGATACACAACTTCAGGACGG - Intergenic
964420051 3:156492572-156492594 AGTCATACAGAAGCTGAGGTAGG - Intronic
965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG + Intergenic
966265504 3:178037199-178037221 AGTTATACAAAAACTGTGGTAGG + Intergenic
971970720 4:33616917-33616939 AGTTAAACACAGTTTGTGATGGG - Intergenic
972873790 4:43332364-43332386 TGTTATTCACCATTTGAGGCTGG + Intergenic
973660582 4:53102007-53102029 ACTTATACAGATTTTGTGGTAGG - Intronic
973782070 4:54297627-54297649 AGTCATATACAAATTCAGGTGGG - Exonic
974233228 4:59145296-59145318 ACTTAACCACAATTAGAGGTAGG + Intergenic
974773396 4:66446116-66446138 AATTATATACAGTTTTAGGTAGG + Intergenic
975634535 4:76433868-76433890 AGCTATACAAAATTTCAGTTAGG - Intergenic
976061373 4:81131582-81131604 ATATTTTCACAATTTGAGGTGGG - Intronic
976069685 4:81227061-81227083 AGTTATAGACAATCTGGGTTTGG - Intergenic
978749916 4:112234362-112234384 AGGTATACTCAACTTGTGGTTGG + Intronic
979655088 4:123182927-123182949 CGTTATACACAGTTTAAGGGGGG + Intronic
980953991 4:139409755-139409777 TGATATACAAAATTTGAGGGAGG + Intronic
981489906 4:145328332-145328354 AGTTCAACACTATTTGAGGAAGG + Intergenic
982695677 4:158597031-158597053 AGTTAAAGACAATTTGTGGGGGG + Intronic
983823953 4:172233438-172233460 ATTTTTACATAATGTGAGGTAGG + Intronic
988884545 5:35541581-35541603 ATTCATACACAATTTCAGGGAGG + Intergenic
989416199 5:41179208-41179230 AGCTATTCACAATATCAGGTTGG - Intronic
989818750 5:45767999-45768021 AGCTATATACATTTAGAGGTAGG - Intergenic
993161372 5:84296608-84296630 AGTTGTACACAAGTTTAGCTTGG - Intronic
995399940 5:111729663-111729685 AGTTATATAAAAATTAAGGTGGG + Intronic
995594755 5:113735748-113735770 AGATAGACTTAATTTGAGGTGGG + Intergenic
1000307858 5:160012288-160012310 AGTTTTACTAAATTAGAGGTAGG - Intronic
1000578493 5:163006652-163006674 AGTCATACATAATCTGTGGTAGG + Intergenic
1000874878 5:166624617-166624639 AGATATATACAATGTGATGTTGG + Intergenic
1000955216 5:167535168-167535190 AGTTATTGACCATTTGGGGTTGG + Intronic
1004557004 6:16708032-16708054 AGCTATGCACAATATGTGGTGGG + Intronic
1004715470 6:18212830-18212852 TGTTATTCACAATTTGAATTTGG + Intronic
1009892306 6:69701196-69701218 TGTTATACATAATTTGACTTGGG - Intronic
1009961941 6:70533909-70533931 AGTTAAACAGAATTTGTGATAGG + Intronic
1011220540 6:85050312-85050334 ACTTTTACACAATTTAAGATTGG - Intergenic
1011305500 6:85921608-85921630 ATTAATACATTATTTGAGGTAGG + Intergenic
1011799090 6:90990857-90990879 AGATGTACATACTTTGAGGTTGG - Intergenic
1012530222 6:100226765-100226787 AGTTATACAGAGTTTCAGTTTGG - Intergenic
1012666010 6:101970827-101970849 ACTTAAACTCAAATTGAGGTAGG - Intronic
1012724273 6:102788274-102788296 AGTTAAAAAAAATTTGAGGCTGG - Intergenic
1013961248 6:115902988-115903010 AGCTATACACAATTTGGGGGAGG - Intergenic
1016626217 6:146172677-146172699 AGTGATACTCAATGTGGGGTTGG + Intronic
1018756981 6:166858403-166858425 AGTTAAACATAAATTCAGGTGGG - Intronic
1022729073 7:33005950-33005972 AGTTATACACTATTAATGGTAGG - Exonic
1023233507 7:38059154-38059176 AGATCTTCACAATTTCAGGTGGG - Intergenic
1027635334 7:80665408-80665430 AGATAGACTCAGTTTGAGGTAGG - Intronic
1027905913 7:84181131-84181153 ACATATACAAAATTTGAGGAGGG - Intronic
1028222271 7:88211691-88211713 GGTCATAGACTATTTGAGGTAGG - Intronic
1029882975 7:103836258-103836280 AGCTACAAACAATATGAGGTAGG - Intronic
1030314868 7:108104289-108104311 AGTTAAACTTAATTTGTGGTGGG + Intronic
1030545727 7:110892674-110892696 AGCTTTTCAGAATTTGAGGTTGG - Intronic
1030556966 7:111038251-111038273 AATTATTCACAATTTGGGGGTGG + Intronic
1030824698 7:114140916-114140938 AGTCTTACACAAGTTGATGTAGG - Intronic
1035699590 8:1627849-1627871 AGTCAGACAGAATGTGAGGTCGG - Intronic
1035699604 8:1628005-1628027 AGTCAGACAGAATGTGAGGTCGG - Intronic
1035699613 8:1628109-1628131 AGTCAGACAGAATGTGAGGTCGG - Intronic
1035699638 8:1628421-1628443 AGTCAGACAGAATGTGAGGTCGG - Intronic
1035699655 8:1628629-1628651 AGTCAGACAGAATGTGAGGTCGG - Intronic
1036932660 8:12971481-12971503 GCTAATACACAATTTGAAGTCGG - Intronic
1041028767 8:53714076-53714098 AGTTATATAAAAATTAAGGTGGG - Intergenic
1041894234 8:62905387-62905409 CTTTATTCACAATTTGAGGTAGG - Intronic
1042381052 8:68114734-68114756 AGTTACATACAATGTGAGGATGG - Intronic
1043341673 8:79247442-79247464 AGTTAAATACAATGTGTGGTAGG - Intergenic
1043982010 8:86654007-86654029 ACTTCTACAAAATTTCAGGTAGG - Exonic
1044337145 8:90999821-90999843 AGCTATATACAATTTGAGGAAGG - Intronic
1050083440 9:1939283-1939305 AGCAATACACAGTTTCAGGTTGG + Intergenic
1050153986 9:2646280-2646302 AGTTTGACACAATTAGAGCTTGG - Intronic
1051222628 9:14866435-14866457 AGTCATAGGCCATTTGAGGTAGG + Intronic
1053234996 9:36445475-36445497 CCTTCTACACAATTTGAGTTTGG + Intronic
1060136484 9:121160321-121160343 AATCATACAAAGTTTGAGGTTGG + Intronic
1061532080 9:131222341-131222363 AGTTTGACAAAATTTGAAGTTGG + Intronic
1187044877 X:15637382-15637404 AGTTTGACACAATTTGTGATGGG - Intronic
1192588910 X:72343471-72343493 AGATTTACAAAATTTGAGTTCGG - Intronic
1193868938 X:86773058-86773080 AGTTACAAATAATTTAAGGTTGG - Intronic
1194127099 X:90032316-90032338 AGTTATACACAATTTGTGTCAGG + Intergenic
1194925665 X:99820257-99820279 AGTGATACTCAATCTGGGGTAGG - Intergenic
1196424276 X:115554422-115554444 ACTTACACAGAATTTAAGGTAGG - Intergenic
1197343588 X:125304553-125304575 ATTTATAAACTATCTGAGGTTGG - Intergenic
1197388471 X:125829538-125829560 AATTATACACAATTTAATGATGG - Intergenic