ID: 1120105721

View in Genome Browser
Species Human (GRCh38)
Location 14:80491905-80491927
Sequence ATATGAACACAGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120105721 Original CRISPR ATATGAACACAGAGGAAGCT GGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
904572708 1:31478863-31478885 ATAAAATCACAGAGGAGGCTGGG + Intergenic
904746242 1:32713011-32713033 ATTTGAAAACAAAGGAGGCTGGG - Intergenic
904777614 1:32920872-32920894 ATAAGGACACAGAGGAAGTGAGG + Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
906305710 1:44717527-44717549 ATGGGAACACAAAGGAAGCCAGG - Intronic
906635073 1:47404063-47404085 ATCTGTACACAGAGGAGGATGGG + Intergenic
906732136 1:48091931-48091953 ATCTGGCCAAAGAGGAAGCTGGG + Intergenic
908426160 1:64009504-64009526 AAATGATCACAAAGTAAGCTGGG - Intronic
909687733 1:78369563-78369585 ATATTAACAAAAAGAAAGCTTGG + Intronic
910274770 1:85437165-85437187 ACATGAACATGGAGGAAGCCTGG + Intronic
910711859 1:90190115-90190137 ATAGGAACACAGAGGCATCCAGG - Intergenic
910857572 1:91710943-91710965 AGATTAACACACATGAAGCTGGG + Intronic
911166837 1:94731755-94731777 CTATGAACAGAGAAGAAACTGGG - Intergenic
912351377 1:109017191-109017213 AAATGAACACAAGGGAAGCCTGG + Intronic
917051507 1:170929970-170929992 ATGAGAACACGGAGGAGGCTTGG + Intergenic
917072850 1:171171093-171171115 ATGAGAAAACAGTGGAAGCTTGG - Intergenic
917137556 1:171802322-171802344 ATATGAAGACAGAGGCAGATTGG + Intronic
917575368 1:176315991-176316013 AAATGACCACAGAGGAGGATGGG - Intergenic
919119492 1:193321501-193321523 GTCTGAACACAAAGGAAGCCTGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064522157 10:16214357-16214379 ACATGAAGACAGAGGCAGATTGG + Intergenic
1064909615 10:20385542-20385564 AAATGAAGTCAGAGGAAGCAAGG + Intergenic
1065037267 10:21652555-21652577 ATATGAAAACAGAGGGAGACTGG + Intronic
1066619219 10:37326156-37326178 AGATGCTCACAGATGAAGCTAGG - Intronic
1067824390 10:49559402-49559424 ACCTGAACACAGAGGTAGCATGG + Intergenic
1067828010 10:49593384-49593406 ATGGGAACACAGAGGAAAATGGG - Intergenic
1068273208 10:54756970-54756992 ATTTGAAGACAGAGGATGCTTGG + Intronic
1068980714 10:63059707-63059729 AGATGAAAAGAAAGGAAGCTGGG - Intergenic
1069387563 10:67897791-67897813 ATAAGAACACAGTGCAGGCTGGG - Intronic
1071552879 10:86580770-86580792 ACCTGAAGAGAGAGGAAGCTGGG + Intergenic
1071731537 10:88253458-88253480 AGATGGACACAGAGGCTGCTGGG + Intergenic
1072957170 10:99897520-99897542 ATATGAAGACAGTGGAGACTAGG - Intronic
1073563022 10:104512938-104512960 ATATTAATTCAGAGGAAGCTGGG - Intergenic
1074280962 10:112051098-112051120 CAATGAAAAAAGAGGAAGCTGGG + Intergenic
1078606938 11:12785268-12785290 ATCTGAAAACTGAGGAGGCTGGG - Intronic
1078866184 11:15299562-15299584 ATATGCACACAAAGGCACCTAGG + Intergenic
1080307827 11:30855562-30855584 ATATGAACACATGGAAAACTCGG - Intronic
1080737368 11:35029964-35029986 ACATGAATTCAGAGGTAGCTTGG + Intergenic
1081029603 11:38062094-38062116 AGATGAAAAGAGAGGAGGCTGGG - Intergenic
1081227263 11:40539097-40539119 ATATGACCACTGAAAAAGCTTGG - Intronic
1085244334 11:75087248-75087270 ATGTTGACACAGAGGAAGTTAGG + Intergenic
1086138563 11:83468380-83468402 ACATGAACAAAGAGGAAAATAGG + Intronic
1086159218 11:83702573-83702595 GTTTGAAGGCAGAGGAAGCTAGG + Intronic
1087153054 11:94875850-94875872 ATGTGAACACATAGGAGGCATGG - Exonic
1088706708 11:112470514-112470536 ACATGCACACAGAGGAAGCGTGG + Intergenic
1088875171 11:113929576-113929598 ATATGAACACCTTGGAAGTTAGG + Intronic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1090050643 11:123375622-123375644 ATATGAATAAAGAGGAAGTTTGG + Intergenic
1091241672 11:134056824-134056846 ATCTGTACCCAGAGGAAGCAAGG - Intergenic
1092402523 12:8188798-8188820 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1092482437 12:8872210-8872232 ATATGAACCAAAAGAAAGCTGGG - Intronic
1092551791 12:9510181-9510203 ATATGTGAACATAGGAAGCTGGG + Intergenic
1092596667 12:10013363-10013385 ATATAAACAAAGAGGAAGAGTGG + Intronic
1092963550 12:13619401-13619423 TGATGAACACAGAGCAAGGTAGG - Intronic
1095155063 12:38843059-38843081 ATATGATCATGGAGGAAGCTTGG + Intronic
1096776799 12:53969327-53969349 ATCTCTCCACAGAGGAAGCTGGG + Intergenic
1097066464 12:56324206-56324228 ATATGCACATTGAGGAAGTTAGG + Intronic
1097142290 12:56912162-56912184 AAATCAACAGAGAGGAAGATGGG + Intergenic
1097329228 12:58315112-58315134 ATATGAACACCCAGGCAGCCTGG + Intergenic
1097438587 12:59581386-59581408 ATATGAATTCAGATCAAGCTAGG - Intergenic
1100552776 12:95662082-95662104 ACATACACACAGAGGAAGATTGG + Intronic
1101292966 12:103389835-103389857 ATATGAAAACAGAGAAAACTGGG - Intronic
1102452907 12:113055103-113055125 AAAGGAACACAGAGGAAGATGGG + Intergenic
1103264756 12:119619343-119619365 ATATGAAAAAAGAGTAGGCTAGG + Intronic
1103553895 12:121754382-121754404 AGATGAACACAGAAGCAGGTAGG - Intronic
1105644371 13:22301669-22301691 ATAGGAACACAAAGGAAGGAAGG - Intergenic
1106404912 13:29465016-29465038 AAATGAAAAAAGAGGAATCTGGG - Intronic
1107394086 13:39997068-39997090 ATGTGAAGACAGAGGCAGATAGG + Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108081261 13:46738855-46738877 TTATGAACTTAGAGAAAGCTAGG - Intronic
1108301701 13:49083796-49083818 GTATGAACACATATGAAGATGGG - Intronic
1110412598 13:75220441-75220463 AGCTGGACACAGAGGAAGATGGG - Intergenic
1111070031 13:83153733-83153755 TTATGAACAAAGAGAAATCTAGG + Intergenic
1111883331 13:93986407-93986429 ATCTGAACAAAGATGAAGCAGGG + Intronic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1113283014 13:108811455-108811477 AGAGGAACAGAGAGGAGGCTTGG - Intronic
1114256912 14:21010980-21011002 ATTTGATCACAGAGCTAGCTGGG + Intergenic
1114466971 14:22929964-22929986 ATATGAACACTGAGAAAACTGGG + Intergenic
1114717790 14:24845804-24845826 ATATAAACACAAAGGAAGGCAGG + Intronic
1115388054 14:32820817-32820839 ATAGGAACACAGAGGAAGGGGGG + Intronic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1115769505 14:36655549-36655571 ATAAGAACACAGAAGACACTTGG - Intergenic
1116579351 14:46619195-46619217 ATATGAAGAAAAAGGAATCTAGG - Intergenic
1116588414 14:46739804-46739826 ATATGATTACAGAAGAGGCTAGG - Intergenic
1116607414 14:47018913-47018935 ATGTGAACACAGAGGACGGACGG - Intronic
1117753292 14:58945950-58945972 AGATGAAGACAGAGGCAGTTGGG - Intergenic
1118280311 14:64422330-64422352 ATATGAACCAAGAAGTAGCTCGG - Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1121226984 14:92328349-92328371 ATCTCAACACAGGGAAAGCTAGG + Intronic
1124249798 15:28099308-28099330 GTAAGAACTCAGAGGGAGCTCGG + Exonic
1126126627 15:45299848-45299870 ACATGAACAAAGAGGAAATTTGG + Intergenic
1126923027 15:53548907-53548929 ATATCAACACAGAGAAGACTGGG + Intronic
1127290712 15:57568317-57568339 ATGTTAACACAGAGAATGCTTGG - Intergenic
1128248389 15:66148530-66148552 ATTTGACCACAGAGGGACCTGGG - Intronic
1128549809 15:68590861-68590883 AGAGGAACACAGAATAAGCTTGG - Intronic
1129012592 15:72435878-72435900 ACATTAACAATGAGGAAGCTGGG - Intergenic
1129702927 15:77778188-77778210 ATGTGACCACAGAGGCAGATTGG - Intronic
1130666184 15:85871883-85871905 ATATGAACACAGAGGATCCAGGG + Intergenic
1135039877 16:19110096-19110118 AAATAAAGACAGAGGTAGCTGGG + Intergenic
1135110253 16:19685334-19685356 ATACCAACACAGATGAATCTTGG - Intronic
1135479137 16:22806799-22806821 ATATGAACACAGATGCAGGTAGG + Intergenic
1135582829 16:23642473-23642495 ATAAAAACACAAAGGAAACTAGG - Intronic
1135606790 16:23832667-23832689 ATATAAAGACAGAGGAGGATGGG + Intergenic
1135798742 16:25472617-25472639 ATATGAGCAGAGTGGAAGATGGG - Intergenic
1138067094 16:53953669-53953691 ATATAAACACGTAGGAATCTTGG + Intronic
1140897858 16:79340928-79340950 ATAGCAAGACAGAGGAAGATGGG + Intergenic
1143770381 17:9164759-9164781 ACATGAACAGAAAGGTAGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146635221 17:34499071-34499093 ATGGGAACACTGAGGAACCTGGG + Intergenic
1149986145 17:61348591-61348613 AGAGGAAAACTGAGGAAGCTAGG + Intronic
1151831309 17:76553519-76553541 ATAAGAACACAAAAGAAGGTAGG - Intronic
1153124770 18:1777801-1777823 GTAAGAACAAAGAGGAAGCTAGG + Intergenic
1156309226 18:35907515-35907537 TAAAGAACACAGAGGCAGCTAGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157790565 18:50527632-50527654 ATATGAACACAGAGTGAGCTAGG + Intergenic
1158564013 18:58538902-58538924 GTATGGACAGAGAGGAAGCAGGG - Intronic
1158627484 18:59084016-59084038 ATATGAACACAGAGGTGGAGAGG - Intergenic
1158650556 18:59280694-59280716 ATCTGAATACAAAGGAGGCTGGG - Intronic
1160290317 18:77587017-77587039 ATATTAGCACAGAGGACCCTGGG - Intergenic
1161545642 19:4878490-4878512 ATATGAACTCCAAGGAAGCCGGG - Intergenic
1163177735 19:15576247-15576269 TTATGTAGACAGAGGAAGCAAGG + Intergenic
1166438024 19:42786080-42786102 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166466926 19:43040743-43040765 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166473057 19:43096818-43096840 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166486729 19:43220357-43220379 CAGTGAACACAGAGGAAGTTTGG - Intronic
925730175 2:6914333-6914355 TTAAGGACACAGAGGAATCTGGG - Intergenic
925794101 2:7524417-7524439 AAATGGACACAGAGGAAGTGAGG - Intergenic
926498953 2:13628543-13628565 AGATGCACTCAGAGGAAACTTGG + Intergenic
929495917 2:42443572-42443594 TTATGAATTCAGAAGAAGCTTGG - Exonic
929834916 2:45386655-45386677 ATATGAGCACAGATGTAGGTAGG - Intergenic
930252599 2:49052282-49052304 ATAAGATCAAAGAGGAAGCTGGG - Intronic
930389750 2:50745993-50746015 ATCTGAACACAGAAGAGGCTGGG - Intronic
931083601 2:58804058-58804080 ATATTAAAACAGAGGGATCTGGG - Intergenic
931179021 2:59881339-59881361 ATATGAAGTCAGAGGAAGATAGG - Intergenic
931218733 2:60270069-60270091 ATGTGAACACTGGGAAAGCTCGG - Intergenic
932889124 2:75575507-75575529 ATAAGAACACACAGGGTGCTGGG - Intergenic
932951202 2:76295758-76295780 ATAACAAAAAAGAGGAAGCTTGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933285707 2:80382545-80382567 ATAGGCACACAGAAGAGGCTGGG + Intronic
933635124 2:84700338-84700360 ATATGAGCACAGATGCAGGTAGG + Intronic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
937675878 2:124589644-124589666 ATATTAGCACAGGGGAAACTGGG - Intronic
938047539 2:128135976-128135998 ATAAGGACACAGAAGAAGTTGGG + Intronic
938785083 2:134620708-134620730 AATTCAATACAGAGGAAGCTTGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
940080943 2:149800634-149800656 AACTGATCAGAGAGGAAGCTGGG + Intergenic
941982831 2:171478229-171478251 ATATGAAAAGAGAGGATGATGGG - Intronic
942517499 2:176769208-176769230 ATATAAAGACAGAGGAAGTGGGG + Intergenic
943309025 2:186303885-186303907 AGAAGATGACAGAGGAAGCTAGG - Intergenic
944568363 2:201015392-201015414 GTAAGAACACAGTGGAAACTAGG - Intronic
944614056 2:201442093-201442115 ATACGAGCAGAGAGCAAGCTGGG + Intronic
945675769 2:212853837-212853859 GTATCAACAGAGAAGAAGCTGGG - Intergenic
946820117 2:223620506-223620528 ATAGGCACACTGAGTAAGCTTGG - Intergenic
947289150 2:228552520-228552542 ATATGAAAACATAGCATGCTTGG - Intergenic
947323547 2:228949371-228949393 ATATGAACACATAGGTATTTGGG + Intronic
948292937 2:236840852-236840874 CTATCAACCCAGAGCAAGCTAGG + Intergenic
1169612082 20:7392841-7392863 ATATGAAAACAGAGGCATTTGGG + Intergenic
1170207783 20:13817949-13817971 AGAAGAACATAGAGGAAGCAGGG + Exonic
1172849020 20:37947295-37947317 ATCTGAAGACAGAGGATGCAAGG - Intergenic
1173152671 20:40581186-40581208 AGATGTACAGAGAGTAAGCTTGG - Intergenic
1173550069 20:43926766-43926788 AGATGAACACAGGGGACACTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174845666 20:53940811-53940833 ATACAAACACAGGGGAAACTAGG - Intronic
1175130737 20:56787643-56787665 AGATGAATTCAGAGGAGGCTGGG - Intergenic
1181287620 22:21765653-21765675 ACATGAATCCAGGGGAAGCTGGG - Intronic
1181597795 22:23928420-23928442 ATCTGAACACAGCGGAAATTTGG + Intergenic
1181877976 22:25955071-25955093 TTATGAAAACACAGGAAACTCGG + Intronic
1183006682 22:34908777-34908799 ATATGAGCAAAGAGGATGCTGGG - Intergenic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
1185207390 22:49547978-49548000 ATGTGAACACAGGAGAAACTAGG - Intronic
949240109 3:1860948-1860970 ATATAATCACAGATGAACCTCGG - Intergenic
951969866 3:28431587-28431609 ATATGACCACATCTGAAGCTAGG + Intronic
951974663 3:28491763-28491785 ATATGAAAATGGAGGCAGCTGGG + Intronic
952848182 3:37706085-37706107 AAATGAAACCAGAGGAAGTTTGG + Intronic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
955075113 3:55606482-55606504 ACATGGACAGAGAGGAAGGTTGG - Intronic
955084736 3:55691852-55691874 ACATGCACTCAGAGGAAGTTAGG + Intronic
955434307 3:58885222-58885244 AGATGTTAACAGAGGAAGCTGGG - Intronic
955860859 3:63328694-63328716 ATGTGACCTCAGAGGAACCTGGG + Intronic
956407754 3:68946542-68946564 ATCTGAACACATAGGCAGTTAGG + Intergenic
959215520 3:103446661-103446683 AGTTGAAAACAGAGGAAGCTGGG + Intergenic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
962179490 3:133190838-133190860 TTATGAACAAAGAGGAATATTGG + Intronic
962211648 3:133484218-133484240 ATGTGGACACAGGGGAACCTTGG - Intergenic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
963199724 3:142573998-142574020 ATGTGAACAAAGAGGAACATGGG + Intronic
963509323 3:146227281-146227303 ATATGCATACAGGGGAATCTGGG + Intronic
963640237 3:147852372-147852394 GTAGGAACACAGAGGGAGTTGGG + Intergenic
963704512 3:148669368-148669390 ATTTGAACACAGATGTAGGTAGG - Intergenic
964307138 3:155354005-155354027 ACATGAAGACAGAGGCAGATTGG - Intergenic
966133815 3:176675367-176675389 ACAAAAACACAGAGGAAGGTTGG - Intergenic
967474440 3:189900206-189900228 ATGGGTACAAAGAGGAAGCTAGG - Intergenic
969086776 4:4662467-4662489 GCAAGAAGACAGAGGAAGCTTGG + Intergenic
970810918 4:20093174-20093196 ATAGCAACACAAAGGAAGCATGG + Intergenic
971573686 4:28246832-28246854 ATATTAACAAAAAGTAAGCTAGG + Intergenic
971802871 4:31315728-31315750 GCATGAATACAGAGGAAGGTGGG - Intergenic
972399510 4:38687779-38687801 ATAAGAACACTGAGCAAGTTAGG + Intronic
972450314 4:39191327-39191349 ATAACAACCCAGAGGAAGCAAGG - Intronic
972450557 4:39193781-39193803 TTATGAAAACACAGGTAGCTGGG + Intronic
972499022 4:39660538-39660560 ATACAAACCCACAGGAAGCTGGG - Intergenic
973152005 4:46899924-46899946 ATAGGAACACTGAGAAATCTAGG - Intronic
973638298 4:52879776-52879798 TGCTGAACACAGAGGAAGCAGGG + Intronic
974198841 4:58612417-58612439 AAATGAACACAGAAGAACATTGG - Intergenic
975391455 4:73822778-73822800 AAATGAAAATAGAGAAAGCTAGG + Intergenic
975846639 4:78532156-78532178 ATAAGATCACAGAGGTAACTTGG - Intronic
975862211 4:78689796-78689818 ATATGGGCACAGAGGCAGGTAGG - Intergenic
976827298 4:89275015-89275037 ATATGAACACTGAGGCAGGATGG + Intronic
977124107 4:93142399-93142421 AGATGACCACTGAGGAAGCAGGG - Intronic
979606188 4:122641494-122641516 ATATGGACACAGATACAGCTAGG + Intergenic
981050566 4:140305666-140305688 ATATAGACAGAGAGGAAGGTAGG + Intronic
981402404 4:144328824-144328846 ATGTCAACAGGGAGGAAGCTAGG + Intergenic
981498447 4:145419716-145419738 ATATGAACAAAGAGGAGGGGTGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982899731 4:160983123-160983145 TAAAGAACACAGAGGAAGATAGG + Intergenic
984285824 4:177727362-177727384 AAATGAAAACAGAGGAAGAGAGG - Intergenic
984407935 4:179357662-179357684 TTAGGAACACAGAAGAAACTAGG - Intergenic
984923129 4:184783303-184783325 GTATAAGCACAAAGGAAGCTGGG - Intronic
985129816 4:186727756-186727778 TTCTGAGCACAGAGGAAACTGGG + Intergenic
986237105 5:5921513-5921535 AAACGAAGAAAGAGGAAGCTCGG + Intergenic
987102997 5:14609069-14609091 ATTTGAACACAGAGGTGTCTGGG + Intronic
987380448 5:17280501-17280523 AAATGAAGACTGAGGAAACTTGG - Intergenic
987385270 5:17323044-17323066 AGATGGACACAGAGGATGTTTGG - Intergenic
988166121 5:27591119-27591141 AGCTGAATAGAGAGGAAGCTGGG - Intergenic
990495293 5:56341520-56341542 GTATGCACACAAAGGAAGTTGGG + Intergenic
993113166 5:83684608-83684630 ATATGAACTGTGAGGGAGCTTGG + Intronic
993399962 5:87437219-87437241 ATATGAATACAAACCAAGCTGGG + Intergenic
993626638 5:90233062-90233084 ATATAAACACAGAGGAATTCAGG + Intergenic
994175357 5:96704608-96704630 ATATGAACATAGAAGAATATGGG - Intronic
994605379 5:101961146-101961168 ATATGAACAAAGAAGAAGTGGGG - Intergenic
994910240 5:105895659-105895681 GTAAGAATGCAGAGGAAGCTGGG + Intergenic
995130804 5:108628510-108628532 AAAAGAACACAGAGTCAGCTAGG + Intergenic
996461553 5:123750762-123750784 ATATGAACATAGTGGAGGGTGGG + Intergenic
997911171 5:137875043-137875065 ACATGAAATCATAGGAAGCTGGG + Intronic
998440278 5:142154919-142154941 ATAAGAACACAGTGAAGGCTGGG - Intergenic
999792330 5:154953061-154953083 ATATGAAGACAGTGAAGGCTGGG + Intronic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1001011517 5:168103289-168103311 ATGTGGACATAGGGGAAGCTGGG - Intronic
1001349181 5:170940210-170940232 ATATGAACGTATAGGAGGCTAGG + Intronic
1001673406 5:173492750-173492772 ACATGCACACAGAGGAAGGCTGG - Intergenic
1001806884 5:174594324-174594346 ATATGTAGACAGAGGAATGTGGG + Intergenic
1002630811 5:180575740-180575762 AAATGAATGCAGAGGGAGCTTGG + Exonic
1003784058 6:9463922-9463944 ATATGAACAAAGTGGAATTTGGG - Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006387212 6:33737937-33737959 ATCTGGACACAGAGGAAAATTGG + Intronic
1007555165 6:42759670-42759692 ATAGGATCACAGAGGAACCCAGG - Intronic
1010180478 6:73081149-73081171 GTTTGAACACAGAAGAGGCTTGG + Intronic
1011938943 6:92818314-92818336 AGATGAAGACAGAGGAATATGGG - Intergenic
1012620131 6:101333980-101334002 AAATGATAACAGAGGAAACTTGG - Intergenic
1013168450 6:107615225-107615247 ACATAAACACAGAGGAAGGAAGG + Intronic
1015982054 6:138849310-138849332 ATATGAACACAGCGTAACCTTGG + Exonic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017427913 6:154341613-154341635 AGATGAAAAAGGAGGAAGCTTGG - Intronic
1017614323 6:156228669-156228691 AGATGAACTCAGCGGAAGCTGGG - Intergenic
1017882129 6:158569312-158569334 AAATGAAGACAGCGGAAGCCAGG + Intronic
1018595052 6:165470185-165470207 ACATGACCAGAGAGGAAGCAAGG + Intronic
1018706481 6:166467438-166467460 ATATGAAAACAGAGCAAGGCCGG + Intronic
1020537680 7:9422486-9422508 ACATGAATCAAGAGGAAGCTGGG - Intergenic
1020586165 7:10071093-10071115 AAATAAACACTTAGGAAGCTAGG + Intergenic
1021524293 7:21569394-21569416 ATATGAAGAGAGAAGAAGTTGGG + Intronic
1021620462 7:22545931-22545953 ATAGGAGCACTGAGGAATCTAGG + Intronic
1024052033 7:45630576-45630598 ATATGAAGACAGAGGGAGACTGG - Intronic
1025763649 7:64419338-64419360 ATATAAAGACACAGGAAGCATGG + Intergenic
1026075496 7:67163362-67163384 AGATGCACACAGAAGAGGCTCGG - Intronic
1026265189 7:68790293-68790315 ATATGAATACAGCTGAACCTGGG - Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027617198 7:80437986-80438008 ATATTAACAATGAGGAAACTGGG + Intronic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028863078 7:95676885-95676907 ATAAGAACACACAGGATCCTAGG + Intergenic
1029176619 7:98669305-98669327 ATATGAACAGAGATGAGGCTGGG + Intergenic
1030481612 7:110111616-110111638 AACTGAACACTGAGGTAGCTGGG - Intergenic
1030925414 7:115447529-115447551 TTATAAACCCAAAGGAAGCTAGG - Intergenic
1032521007 7:132545149-132545171 ATAGGAGCACAGAGGACACTGGG - Intronic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1032902333 7:136323794-136323816 AAAAGAACACAGAACAAGCTAGG - Intergenic
1033135162 7:138778076-138778098 ATATGAACATACATGAGGCTGGG + Intronic
1033785096 7:144720579-144720601 AAATCAAAACAGAGGAAGCCTGG + Intronic
1034043306 7:147901732-147901754 TTATGAACACAGAGGAGAGTGGG - Intronic
1034637216 7:152576911-152576933 AGAAGAACACACAGGAAGCAGGG - Intergenic
1034731628 7:153392206-153392228 ATTAGAACAGAGAGGAAGGTTGG + Intergenic
1035190512 7:157163443-157163465 ATATTACCCCAGAGGAAACTGGG - Intronic
1036196238 8:6717742-6717764 ATATGAACACAAATTAAGCCCGG - Intronic
1036275572 8:7348798-7348820 AATTGAACAGAGAGGAAGCAGGG - Intergenic
1036345775 8:7961559-7961581 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1036580760 8:10073298-10073320 ATAAAAACACTGAGGAAGTTAGG - Intronic
1036841111 8:12122313-12122335 AATTGAACAGAGAGGAAGCAGGG + Intergenic
1036862910 8:12368565-12368587 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1037064688 8:14563174-14563196 AAATCCACACAGAGCAAGCTTGG - Intronic
1038719523 8:30021459-30021481 AAAGAAACACAGAGGAGGCTGGG + Intergenic
1040586399 8:48746920-48746942 ATAAGAACTCCCAGGAAGCTTGG - Intergenic
1040891455 8:52321238-52321260 GGAGGAGCACAGAGGAAGCTGGG + Intronic
1041930450 8:63280731-63280753 ATAAGAACATACAGCAAGCTGGG + Intergenic
1042324916 8:67518418-67518440 ATAAGAACACTGTGGTAGCTGGG + Intronic
1042676761 8:71329966-71329988 ATTTGAACACAGACGAAGTTAGG + Intronic
1043593997 8:81863568-81863590 AGCTGAAGAAAGAGGAAGCTGGG + Intergenic
1043967458 8:86495186-86495208 ATCTGAAAAAGGAGGAAGCTGGG + Intronic
1045512865 8:102827181-102827203 ACCTGAACACAGAGTAAGTTAGG + Exonic
1045615412 8:103903910-103903932 ATATAACCACTGAGGAAACTCGG - Intronic
1045695264 8:104802211-104802233 AAAATAAGACAGAGGAAGCTTGG + Intronic
1046290156 8:112148717-112148739 ATATTTAAACAGAGGAAACTGGG - Intergenic
1046664939 8:116990764-116990786 ATGTTAACACAGGGGAAACTGGG + Intronic
1046673898 8:117087966-117087988 AGATGAACAGAGAGGAAGAAAGG + Intronic
1047148852 8:122237953-122237975 ATATGAAGACAGAGGAAAAGAGG - Intergenic
1047291287 8:123532504-123532526 CTATGAACACAGAGGGAATTGGG + Intronic
1048927058 8:139280821-139280843 ATATGAACACCTTGAAAGCTGGG - Intergenic
1049189423 8:141278713-141278735 AGCTGACCAGAGAGGAAGCTGGG + Intronic
1049192612 8:141296888-141296910 ATATGAAGACAGAGCAAGAAGGG + Intronic
1049676338 8:143890954-143890976 ACCTGAACACAGGGGACGCTGGG - Intergenic
1049996427 9:1039106-1039128 TTATTAACACACAGGAATCTAGG + Intergenic
1052907652 9:33850524-33850546 ATAAGGACACAGATGAAACTTGG - Intronic
1053594884 9:39549684-39549706 ATTAGTACACAGAGGAAGCAGGG - Intergenic
1053852665 9:42304718-42304740 ATTAGTACACAGAGGAAGCAGGG - Intergenic
1054571370 9:66815283-66815305 ATTAGTACACAGAGGAAGCAGGG + Intergenic
1055002220 9:71464639-71464661 ATGTTAACAATGAGGAAGCTTGG + Intergenic
1055317123 9:75045113-75045135 AAATGTTGACAGAGGAAGCTGGG - Intergenic
1057296607 9:93848357-93848379 AGCTGAATAGAGAGGAAGCTGGG + Intergenic
1057522984 9:95774925-95774947 AAGTGAACACAGGGAAAGCTGGG + Intergenic
1057755210 9:97829346-97829368 ATATGAGCACAGGGGACGATGGG + Intergenic
1058060902 9:100494651-100494673 ATATGAACACAGAGCGAGGGAGG + Intronic
1059843547 9:118245628-118245650 CTATGAAGACACAGGCAGCTTGG - Intergenic
1061062195 9:128256063-128256085 ATATGTACACTGGGGAAGCAGGG + Exonic
1061398621 9:130356484-130356506 AGATGGACAGAGAGGAAGCTGGG - Intronic
1061454483 9:130687511-130687533 ACATGAAAACAGAGGCAGCAGGG - Intergenic
1062723088 9:138054551-138054573 ATATTCACACAGAAGCAGCTGGG - Intronic
1185569549 X:1123157-1123179 GGATGAACCAAGAGGAAGCTGGG - Intergenic
1188486882 X:30691895-30691917 ATATGAACAAAGTGGAAGAGGGG - Intronic
1189166153 X:38863158-38863180 ATATGATCACAGAGGCAGAGAGG + Intergenic
1189676394 X:43464891-43464913 ATAAGACCAGATAGGAAGCTGGG - Intergenic
1189981524 X:46515529-46515551 ATAAGATCACAGAACAAGCTGGG - Intronic
1194834439 X:98664043-98664065 ATTTCAGCCCAGAGGAAGCTCGG - Intergenic
1196743035 X:119042184-119042206 GTATGAACACAGAGAACCCTGGG - Intergenic
1197599945 X:128517327-128517349 TACTGAAGACAGAGGAAGCTGGG + Intergenic
1197637262 X:128929004-128929026 GAATGAGCACAGAGGAAGCATGG - Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1198601655 X:138290773-138290795 ATATGAATCCTGAGGAAACTAGG + Intergenic
1199622660 X:149713899-149713921 GGATGAAAACAGAGGAAGCAAGG - Intronic
1200328011 X:155263234-155263256 GTATGAACACAGAGGAGGAAAGG - Intronic
1200361411 X:155611258-155611280 ATATGAGCCCAGGGGATGCTTGG + Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic