ID: 1120107973

View in Genome Browser
Species Human (GRCh38)
Location 14:80517905-80517927
Sequence CTGGATCAGGAGGAGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120107968_1120107973 6 Left 1120107968 14:80517876-80517898 CCTGACTGGGAGTGGCAATGGGC 0: 2
1: 13
2: 42
3: 108
4: 269
Right 1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG 0: 1
1: 0
2: 2
3: 48
4: 431
1120107965_1120107973 13 Left 1120107965 14:80517869-80517891 CCTTTATCCTGACTGGGAGTGGC 0: 1
1: 1
2: 5
3: 35
4: 189
Right 1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG 0: 1
1: 0
2: 2
3: 48
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120107973 Original CRISPR CTGGATCAGGAGGAGCACAG TGG Intronic
900120409 1:1046448-1046470 CTGGCTCAGGAGGAGCCCTGGGG - Exonic
900267054 1:1762918-1762940 CTGGACCCTGAGGAGCACAGCGG - Intronic
901107206 1:6765809-6765831 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
901292309 1:8133482-8133504 CAGTCTCAGGAGGAGAACAGAGG - Intergenic
901896863 1:12321051-12321073 CATGCTCAGGAAGAGCACAGCGG - Intronic
901953570 1:12768670-12768692 CTGGCTCAGCAGGAGCCCTGTGG - Intergenic
901969401 1:12895482-12895504 CTGGCTCAGGAGGAGTAGTGGGG - Intronic
902547048 1:17196687-17196709 CTGGATCGTGAGAACCACAGCGG + Intergenic
902593689 1:17493591-17493613 CTGGATCAGAGTGAGCAGAGGGG - Intergenic
903233489 1:21935855-21935877 CTGAAACAGGAGGACGACAGAGG + Intronic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
903770171 1:25758800-25758822 ATGGATCAGCAGGAGGGCAGTGG + Intronic
903830481 1:26171330-26171352 CTGCATCTGGAGGTGCACAGAGG + Exonic
904949268 1:34223149-34223171 CTGGATCAGGAAAAGCACTGAGG - Intergenic
905234394 1:36535953-36535975 CTAGGGCAGGTGGAGCACAGAGG + Intergenic
906286575 1:44591765-44591787 CTGGAGGAGGAGGAGGACAGAGG - Intronic
906367406 1:45222877-45222899 CTTGAAGATGAGGAGCACAGTGG + Intronic
906412432 1:45589610-45589632 CTGGATCAGGCTGGGCGCAGTGG + Intronic
906636280 1:47412636-47412658 CTGGGGCGGGAGGAACACAGTGG - Intergenic
907107397 1:51896295-51896317 GTGGATGAGGTGGGGCACAGTGG - Intergenic
909268834 1:73597513-73597535 CTTGAAGATGAGGAGCACAGTGG + Intergenic
910800894 1:91144864-91144886 CTTGAAGATGAGGAGCACAGTGG - Intergenic
911181779 1:94867308-94867330 CTGGATCAGGTTGAGAACAAAGG - Intronic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
913675764 1:121138770-121138792 CAGGATCTGTCGGAGCACAGAGG - Intergenic
914027662 1:143926710-143926732 CAGGATCTGTCGGAGCACAGAGG - Intergenic
914348134 1:146817251-146817273 CTGGATCATGGGGAGTCCAGGGG + Intergenic
914523130 1:148435981-148436003 CTGGTGAAGGAGAAGCACAGAGG + Intergenic
914992638 1:152511893-152511915 CTGGGCCATGAGGAGCACGGAGG + Exonic
915569845 1:156738572-156738594 ATGGATCAGGCGGCGCCCAGTGG - Exonic
917236791 1:172901368-172901390 CTTGATGAGGAGGATCAGAGGGG - Intergenic
918202414 1:182279806-182279828 CTGGATCAGGGGGTGGAGAGTGG - Intergenic
918851170 1:189692665-189692687 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
919175134 1:194010317-194010339 CTGGAGCAGGTGGGACACAGGGG - Intergenic
919519387 1:198568382-198568404 CTTGATCAGGCTGGGCACAGTGG + Intergenic
920219166 1:204383677-204383699 AGGGAACAGAAGGAGCACAGAGG + Intergenic
920463132 1:206157607-206157629 CAGGATCTGTCGGAGCACAGAGG - Intergenic
920641920 1:207760788-207760810 CAGGAGCAGGAGGAGCAAGGTGG + Intronic
921167455 1:212517199-212517221 CAGGATTTGGAGGAGGACAGAGG + Intergenic
921194307 1:212739048-212739070 CTGGATCAGCAAGGGCACAGTGG - Intronic
921291455 1:213661541-213661563 CTGAATCAGGAGGAAGTCAGAGG + Intergenic
922923556 1:229329204-229329226 CTGGAACAGGAGGAAGAGAGGGG - Intronic
924049968 1:240070777-240070799 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
924154636 1:241163487-241163509 CTAGATCTGGAAGAGGACAGGGG - Intronic
924740941 1:246794004-246794026 CAGGGGCAGGGGGAGCACAGGGG + Intergenic
1063042407 10:2356755-2356777 CTGAAGCAGGAGAATCACAGAGG + Intergenic
1063044888 10:2381840-2381862 TTGGATCAGGCTGGGCACAGTGG - Intergenic
1063138781 10:3238853-3238875 CTGGTCCAGGAAGGGCACAGAGG + Intergenic
1063159283 10:3408133-3408155 CTGGAGCAGGAGGAGGTAAGAGG + Intergenic
1063627182 10:7701214-7701236 TGGGATCAGGCTGAGCACAGTGG + Intergenic
1063721250 10:8583864-8583886 GAGGAACAGGTGGAGCACAGGGG + Intergenic
1064534189 10:16341882-16341904 CAGCATCTGGAGCAGCACAGGGG + Intergenic
1065786436 10:29220089-29220111 CTGGAGCAGGAGGAAGAGAGGGG - Intergenic
1066321742 10:34309515-34309537 CTTGCTCAGCAGGAGTACAGTGG - Intronic
1066661117 10:37738946-37738968 CAGGTTCAGGAGGAGCTAAGGGG - Intergenic
1067658980 10:48219437-48219459 GTGTATCAGTAGGAGCAGAGAGG - Intronic
1069277984 10:66616728-66616750 CTGGGTCAGGAGGAGCTAATAGG - Intronic
1069323633 10:67204377-67204399 CTGGAGCAGGAGGAAGAGAGAGG - Intronic
1069571991 10:69499893-69499915 CTGGAGCAGAGGGAGCACAGCGG + Intronic
1069712030 10:70495769-70495791 CTGGGGCAGGAGGATCACTGAGG + Intronic
1069717796 10:70532131-70532153 ATGGAGGAGGAGGAGGACAGAGG - Intronic
1070796345 10:79219122-79219144 CTGGATCAGGAAGACAAGAGTGG + Intronic
1070837438 10:79458742-79458764 CTGGGGCAGGTGGAGGACAGAGG - Intergenic
1071250197 10:83810115-83810137 ATGGAAGAGGAGCAGCACAGAGG - Intergenic
1071436584 10:85653383-85653405 CTGGACTAAGAGGAGCAGAGAGG + Intronic
1073054464 10:100690253-100690275 CTGAATCAGGCCGAGCACCGTGG - Intergenic
1073068198 10:100776625-100776647 CTGCATCAGCAGGCACACAGAGG - Intronic
1073321860 10:102620475-102620497 CAGCACCAGGTGGAGCACAGTGG + Intronic
1073438624 10:103538281-103538303 CTGGATTAGGCTGAGCACGGTGG + Intronic
1075035594 10:119064525-119064547 CTGGAGCAGGAGGAAGACAGAGG - Intronic
1075688660 10:124380645-124380667 TGGAATCGGGAGGAGCACAGAGG - Intergenic
1075725366 10:124608164-124608186 CTGGATCAGGAGGGTCAGAAAGG - Intronic
1075851863 10:125595561-125595583 GTGGCTGGGGAGGAGCACAGAGG - Intronic
1076075798 10:127532923-127532945 CTAGAGGAAGAGGAGCACAGAGG - Intergenic
1076222438 10:128745404-128745426 CTGGAACAGGACCTGCACAGGGG - Intergenic
1076509264 10:131000489-131000511 CTGGATCAGGAGGCCCAGAGAGG - Intergenic
1076574362 10:131453938-131453960 GAGGAGCGGGAGGAGCACAGGGG - Intergenic
1076667892 10:132103232-132103254 CAGGAGCAGGAGGGCCACAGAGG + Intergenic
1076989060 11:260058-260080 CTTGAGAAGGAGGACCACAGAGG + Intergenic
1077815936 11:5685350-5685372 CAGGAGCAAGAGGAGCACATTGG - Intronic
1078157757 11:8813478-8813500 GAGGATCAGGAGGAGAGCAGAGG - Intronic
1078438071 11:11341832-11341854 CTTGATCAGGCTGGGCACAGTGG + Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1078750345 11:14155444-14155466 CTGGAGCAGGAGGAAGGCAGGGG + Intronic
1079498941 11:21079939-21079961 CTGGATGAGGAGGGGAATAGAGG + Intronic
1081441618 11:43086954-43086976 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1081866176 11:46361865-46361887 CTGGCTCAGCAGGAGCTCGGGGG - Intronic
1081999169 11:47383580-47383602 ATGGAGGAGGAGGAGGACAGAGG + Intergenic
1083079822 11:60079648-60079670 CAGGGTGAGGAGGAGCAGAGGGG - Intergenic
1083418264 11:62539320-62539342 CTGCTCCAGGAGGAGGACAGGGG - Intronic
1083541758 11:63516242-63516264 CTGGAACAGGAGCAGCACCTGGG - Exonic
1084524650 11:69688370-69688392 CTGGACTTGGAGGAGAACAGTGG - Intergenic
1084524775 11:69689607-69689629 CTGGACTTGGAGGAGAACAGTGG - Intergenic
1086347236 11:85909462-85909484 CTGGATCAGGAGGTGCTCATGGG - Intronic
1086947773 11:92860247-92860269 TTTGATCAAGAGGAGGACAGTGG + Intronic
1087168703 11:95028649-95028671 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1088259298 11:107928939-107928961 CTGGAAGAGGAGGGGCAAAGGGG - Intronic
1088943419 11:114484104-114484126 CAGCATCAGTAGGAGCCCAGTGG - Intergenic
1089304495 11:117517999-117518021 CTGGCTCAGTGGGAGGACAGAGG + Intronic
1090092811 11:123713976-123713998 CTGGATAAGGAGCAGAGCAGTGG - Intergenic
1091661450 12:2386885-2386907 CTGGGTCAGGTGGAGGACTGGGG - Intronic
1091779040 12:3202306-3202328 GTGGTCCAGGAGGAGCACTGGGG + Intronic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1092231805 12:6779937-6779959 CTGGAGCAGGAGGGGCATGGTGG + Intergenic
1092283601 12:7115632-7115654 CTGACTCAGGAAGAGCACAGTGG + Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093290338 12:17311927-17311949 CTGGAGCTGGATGCGCACAGTGG - Intergenic
1093677207 12:21957204-21957226 CTGGAACATGAAGAGCATAGTGG + Intergenic
1096476584 12:51912712-51912734 CTGGATCAAGAGGAGAGCAAAGG - Intronic
1097182375 12:57178788-57178810 CTGGAACAGGGGGAGGAGAGTGG + Intronic
1097626431 12:62007104-62007126 CTGGAGCAGAAGGAGCATGGGGG - Intronic
1097671752 12:62548018-62548040 CTTCAGCAGGAGGAGGACAGAGG + Intronic
1097813972 12:64051009-64051031 CTGGATTAGGCTGGGCACAGTGG - Intronic
1098143113 12:67470836-67470858 CTGCAACAGGCCGAGCACAGTGG + Intergenic
1101454922 12:104820930-104820952 CTGCATTAGGCGGGGCACAGTGG - Intronic
1102161674 12:110774202-110774224 GTGGATGAGGACGGGCACAGTGG + Intergenic
1102762524 12:115400797-115400819 CTGGATGAGGCTGGGCACAGTGG + Intergenic
1102905482 12:116671570-116671592 AGGGATGAGGAGGAGCACATGGG - Intergenic
1103781745 12:123403326-123403348 CTGGATCAGGAGGGAAACAGTGG - Intronic
1104221289 12:126787218-126787240 ATGGAGGAGGAGGAGCACAGAGG + Intergenic
1105254762 13:18736521-18736543 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1105424673 13:20284202-20284224 CTGGATAGGAAGGAGCAGAGGGG - Intergenic
1106487835 13:30188265-30188287 GTTGATCAGGAGGATCCCAGAGG - Intergenic
1108207480 13:48105518-48105540 CTGGAGTAGGCGAAGCACAGAGG + Intergenic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1109391104 13:61694857-61694879 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1111175909 13:84596085-84596107 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1112644737 13:101317554-101317576 CCAGATCAGGTGGATCACAGAGG - Intronic
1112749849 13:102571164-102571186 CTGCTTCAGCTGGAGCACAGAGG + Intergenic
1113010881 13:105764516-105764538 CTGGATTTGGATGAGCAGAGAGG - Intergenic
1113353053 13:109548489-109548511 GAGGGTCAGGAGGAGGACAGAGG - Intergenic
1113416366 13:110131588-110131610 CAGCAGCAGGAGGAGGACAGAGG - Intergenic
1113747482 13:112755053-112755075 ATGGCTCAGGAGGACCACTGTGG + Intronic
1113866928 13:113532538-113532560 ATGGATCAGGAGGAGGCCACTGG + Intronic
1113870057 13:113553838-113553860 CTGGAGGGGGAGGAGCCCAGAGG - Intronic
1113943339 13:114029741-114029763 CTGGCTCCCGAGGAGCACACAGG - Intronic
1114172692 14:20289446-20289468 CTGGAACATGATGAGGACAGAGG + Exonic
1114620505 14:24093789-24093811 CTTGATCAGGAGGAGAAACGGGG + Intronic
1116035980 14:39627432-39627454 TTGGATGAGGGGGAGCACACAGG - Intergenic
1117429246 14:55636493-55636515 CTACATCAGGAAGAGAACAGCGG + Exonic
1117863895 14:60124732-60124754 CAGGATCAGTAGAATCACAGAGG + Exonic
1118395764 14:65335135-65335157 CTTGAACAGGAGGAGCAAGGCGG - Intergenic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1118671761 14:68136286-68136308 GTGGATCAGGCCGGGCACAGTGG + Intronic
1119029802 14:71183175-71183197 CCGCCTCAGGAGGGGCACAGTGG - Intergenic
1119568982 14:75653315-75653337 CTGGGTCAGGCCGGGCACAGTGG + Intronic
1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG + Intronic
1120462356 14:84813495-84813517 CTGGATCAACCAGAGCACAGTGG - Intergenic
1120541485 14:85756582-85756604 CTTGAAGATGAGGAGCACAGTGG + Intergenic
1120848374 14:89146649-89146671 CTGGATAAAGAGGAACAGAGAGG - Intronic
1121110417 14:91308937-91308959 CAAGATCAGGCCGAGCACAGTGG + Intronic
1121189428 14:92012531-92012553 CTAGATTAGGAGGAGCAAATGGG + Intronic
1122139565 14:99654445-99654467 CTGGAGAGGGAGGAGCACTGGGG - Intronic
1122642525 14:103168529-103168551 CTGCCTCAGTTGGAGCACAGAGG - Intergenic
1123681840 15:22769306-22769328 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681930 15:22769810-22769832 CGGGAGCAGGAGGAGCAGATGGG - Intergenic
1123681982 15:22770101-22770123 CAGGAGCAGGAGGAGCAGATGGG - Intergenic
1124453276 15:29818025-29818047 TTGTATCAAGTGGAGCACAGTGG - Intronic
1124462525 15:29905868-29905890 GTGGAACAGGTGGAGCACAGAGG + Intronic
1124964420 15:34422802-34422824 CAGGAGCAGGAAGAGCACTGTGG - Intronic
1124981039 15:34569028-34569050 CAGGAGCAGGAAGAGCACTGTGG - Intronic
1125052324 15:35314566-35314588 CTTGAAGATGAGGAGCACAGTGG + Intronic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1128079624 15:64848649-64848671 CTGGATCAAGAAGAGCAGTGGGG + Exonic
1128612649 15:69086462-69086484 CTGCATCAGGAGGGGAAAAGGGG + Intergenic
1128795752 15:70465369-70465391 CAGGAGCATTAGGAGCACAGTGG - Intergenic
1129109163 15:73327744-73327766 CAGGATGAGGATGAGCATAGGGG - Intronic
1131104462 15:89722719-89722741 CTTGGTCAAGAGGAGCAGAGAGG + Intronic
1131457118 15:92590235-92590257 CTGGATGAGCAGGAGTCCAGGGG - Intergenic
1132256832 15:100383538-100383560 CTGGTGCAGAAGGAGCCCAGGGG + Intergenic
1132779240 16:1614034-1614056 CTGGCCCTGGAGGAGGACAGAGG - Intronic
1132862918 16:2080321-2080343 CTGGGTCAGCAGGGGCACATAGG - Exonic
1132917047 16:2355153-2355175 CTGGAGCAGGAGGAAGAGAGTGG + Intergenic
1133870027 16:9677451-9677473 CCAGAGCAGGAGGAGGACAGAGG + Intergenic
1134344755 16:13379453-13379475 CTGGAGCAGGAGGAGGGAAGTGG - Intergenic
1134628720 16:15741509-15741531 CTGGAGGAGGAGGAAGACAGGGG - Exonic
1134632914 16:15769946-15769968 CTGGAACAGGCTGGGCACAGTGG - Intronic
1136025516 16:27465780-27465802 CTTGAGCAGGAGAATCACAGTGG - Intronic
1136170076 16:28483843-28483865 CTTGTTGAGGACGAGCACAGTGG - Intronic
1136267400 16:29129803-29129825 CCCGATCGGGAGGGGCACAGAGG - Intergenic
1136454341 16:30371775-30371797 GTGGAACATGAGGAGCACAGAGG - Intronic
1136558711 16:31025531-31025553 CTGGCTCAGGAGGTTCTCAGTGG + Intergenic
1137000207 16:35222389-35222411 GTTGATCAAGAGAAGCACAGAGG - Intergenic
1138105440 16:54285177-54285199 CTGGAGGAGGAGGAGCTCGGGGG - Exonic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1138235648 16:55380185-55380207 CTGGGTCAGGGAGAGCAGAGGGG - Intergenic
1138474457 16:57262634-57262656 CTGAAGCAGGAGGATCACATGGG + Intronic
1139985903 16:70898294-70898316 CTGGATCATGGGGAGTCCAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141652024 16:85397831-85397853 CTGGAGGAGGAGGATCCCAGGGG - Intergenic
1142070692 16:88090126-88090148 CCCGCTCAGGAGGGGCACAGAGG - Intronic
1142121878 16:88390489-88390511 TTGGGTCAGGAGGAGCAGTGGGG - Intergenic
1142178927 16:88657820-88657842 CTGCCTCAGGAGGGGCACAGAGG + Intronic
1142349074 16:89571485-89571507 CTGGCTCAGGAGGGCCAAAGGGG + Intergenic
1143719673 17:8800731-8800753 CTGAATCAGGAGCTGCACACTGG - Intergenic
1144021133 17:11240968-11240990 CGGGAGCAGGAGGAGAACCGCGG - Intergenic
1144714839 17:17426762-17426784 CTGGATAGGGAGGAGCAGAGGGG - Intergenic
1144750160 17:17642877-17642899 CTGCTTCTGGAGGAGCCCAGTGG - Intergenic
1144896786 17:18543043-18543065 CTGGAGAAGGACGAGCACTGTGG + Intergenic
1144948175 17:18980431-18980453 CTTGGGCATGAGGAGCACAGCGG + Intronic
1145276963 17:21437317-21437339 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1145713235 17:26995147-26995169 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1145769191 17:27480131-27480153 CTGGAGCAGGATGAGCAATGGGG - Intronic
1146182447 17:30706897-30706919 CTGGATCTGGGGGACCAAAGGGG - Intergenic
1147623533 17:41884302-41884324 CAGGATCAGGAGGAGGCCTGGGG + Intronic
1147660127 17:42112930-42112952 CTGGATCAGGAGCAGCCTGGAGG + Intergenic
1148205172 17:45775432-45775454 CAGCTGCAGGAGGAGCACAGAGG - Intergenic
1148337736 17:46852448-46852470 TTGGAAAAGGAGGATCACAGTGG + Intronic
1148897107 17:50845410-50845432 CTGGATCAGCACAAACACAGAGG - Intergenic
1148930028 17:51120613-51120635 GTGTATCAGGAGGAGCCCGGCGG - Exonic
1149262322 17:54893444-54893466 TAGAATCAGGAGAAGCACAGGGG + Intergenic
1149520995 17:57318238-57318260 CTGGAAGAGGAGGACCATAGAGG + Intronic
1149996261 17:61407535-61407557 CTGGGCCAGGAGGAGGACACGGG - Intronic
1150678344 17:67264106-67264128 CTGGAACAGGCTGGGCACAGTGG + Intergenic
1151765303 17:76130663-76130685 CAGGAGCAAGAGGAGCAGAGAGG - Intergenic
1151868071 17:76818059-76818081 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1151885584 17:76921536-76921558 CTGCATCAGGTGGGGCTCAGCGG + Intronic
1152331693 17:79677322-79677344 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1152471620 17:80492714-80492736 CTGGGTCTGGAGGGGCACAGAGG - Intergenic
1152914442 17:83026151-83026173 CTGGCTGAGCAGGAGCAAAGGGG - Intronic
1152998550 18:431589-431611 ATGCATGAGGAGGAGCACACTGG + Intronic
1153278876 18:3395347-3395369 CTGGAGCTGGAGGATCCCAGGGG + Intergenic
1153543036 18:6177459-6177481 CTGGCTGAGAAGGAGCACAAAGG + Intronic
1154034255 18:10783982-10784004 CTGTATTGAGAGGAGCACAGAGG - Intronic
1154239400 18:12638812-12638834 CTGGAGCAGGAGGAAGAAAGAGG - Intronic
1154436265 18:14344082-14344104 CTGAATCAGGAGGAGAAAAGAGG - Intergenic
1155794191 18:30013460-30013482 CTGGAAGATGAGGAGCATAGTGG + Intergenic
1157061005 18:44290406-44290428 CTGGAGCAGAAGGAGAACACTGG + Intergenic
1157245634 18:46051958-46051980 ATGGATCAGGAGGAGACCCGTGG - Intronic
1157473519 18:48007586-48007608 CTGGAGCAGGAGTGGCACTGAGG + Intergenic
1158961288 18:62589719-62589741 GATGAACAGGAGGAGCACAGAGG - Intergenic
1159609008 18:70505955-70505977 CTGAATCAGAAAGAACACAGAGG - Intergenic
1159973906 18:74686504-74686526 CTGGATCAGGGAGCGAACAGAGG - Intronic
1160030840 18:75258169-75258191 GTGGCTGTGGAGGAGCACAGAGG - Intronic
1160212928 18:76898134-76898156 CTGGGCCAGGAGGAGGACCGGGG + Intronic
1161265581 19:3362114-3362136 CTGGTGCAGGAGGAGCAGGGAGG + Intronic
1161469131 19:4447677-4447699 CTGGAGCAGGAGGCACAGAGGGG - Intronic
1161797256 19:6394172-6394194 AAGGAGCAGGAGAAGCACAGCGG + Intergenic
1161998646 19:7730008-7730030 CTGGATGAGCAGGTGCGCAGGGG - Exonic
1162097371 19:8318565-8318587 CTGGACCAGGAGGATCACTTAGG + Intronic
1162627754 19:11899076-11899098 TAGAATTAGGAGGAGCACAGGGG - Intronic
1162636570 19:11973162-11973184 TAGAATTAGGAGGAGCACAGGGG - Intronic
1163161715 19:15468831-15468853 CTGGATCAGGGAGGGGACAGTGG + Intronic
1164802893 19:31092337-31092359 CGGCATCAAGAGGAACACAGCGG - Intergenic
1165858678 19:38895157-38895179 CTGGACCAGGTGGAGCGCCGGGG - Intronic
1166106521 19:40600585-40600607 CTGGAGCGGGAGGAGGGCAGGGG - Intronic
1166337573 19:42117477-42117499 CTGGCACAGGAGGAGCAGACTGG + Intronic
1167060752 19:47144410-47144432 CTGGATCAGGCCAGGCACAGTGG + Intronic
1168115264 19:54218677-54218699 CTGGACCTGGAGGAGGACATGGG + Exonic
1168514453 19:57000148-57000170 CTACATCAGGATGGGCACAGTGG + Intergenic
1168700326 19:58434947-58434969 CAGCACCAGAAGGAGCACAGTGG - Exonic
925495992 2:4449857-4449879 GGGGATCAAGAGGAGCTCAGGGG + Intergenic
925839647 2:7979588-7979610 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
926367116 2:12143706-12143728 CTTGATCTGGAGGATCACATGGG + Intergenic
926610314 2:14940341-14940363 CTGGAGCAGGAGGAAAAGAGAGG - Intergenic
926646995 2:15300890-15300912 CTGGATCTGCATGTGCACAGAGG + Intronic
926711809 2:15888120-15888142 CTGTTACAGGAGGAGCACAGGGG + Intergenic
926908907 2:17830852-17830874 GTGGATAAGGAAGAGCAGAGCGG + Intergenic
927193373 2:20532023-20532045 CTGGAACAGGAGAAGGGCAGAGG + Intergenic
929253418 2:39782999-39783021 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
931093711 2:58915880-58915902 CTGGTTCAGGGAGAGCACAGTGG - Intergenic
931159501 2:59673356-59673378 CTGGAGCTGGAAGAGAACAGGGG - Intergenic
934673137 2:96229612-96229634 CTGAAGCAGGAGGACCACTGGGG - Intergenic
936376641 2:111946901-111946923 TTGGATAAGAAGGAGCACAGAGG - Intronic
937305255 2:120867002-120867024 CCGGCTCAGAAGGTGCACAGTGG + Intronic
938344681 2:130558615-130558637 CAGGATCAGGAAGAACAGAGGGG + Intergenic
938345152 2:130562105-130562127 CAGGATCAGGAAGAACAGAGGGG - Intergenic
940127355 2:150341542-150341564 CTGGAACAGGAGGAAGAGAGAGG - Intergenic
940179171 2:150913128-150913150 CTGGATCAAGAGCAAGACAGAGG - Intergenic
940449962 2:153824834-153824856 CTGGAGCAGGAGGGACAGAGAGG - Intergenic
941304167 2:163840872-163840894 CTGGATCATGAGAAGGACAGCGG + Intergenic
942806209 2:179934039-179934061 CTGAATCAGGTCAAGCACAGTGG + Intergenic
943635365 2:190301165-190301187 CTGGCTCAGGAGGGAAACAGAGG + Intronic
943748193 2:191484243-191484265 GTGGATCAGGAGGAGTAAACAGG - Intergenic
945013200 2:205486627-205486649 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
946023482 2:216657620-216657642 CTCCATGTGGAGGAGCACAGAGG + Intronic
946025766 2:216670869-216670891 ATGCATTAGGAGGTGCACAGAGG - Intergenic
946255989 2:218442243-218442265 CTGGATCAGGCTGAGCTTAGGGG + Intronic
947428859 2:230008014-230008036 TTGGGCCAGGATGAGCACAGTGG - Intronic
947988536 2:234468679-234468701 CTGGAGCAGCAGGAGCTCTGCGG - Intergenic
948579092 2:238971895-238971917 CAGGGTCAGGAGGAGTCCAGAGG + Intergenic
1168988860 20:2077197-2077219 ATGAATAAGGAAGAGCACAGAGG + Intergenic
1169260499 20:4134838-4134860 CTGAAGGAGGAGGGGCACAGTGG + Intronic
1169518538 20:6345456-6345478 CTGGAGCAGGAGGAAGAGAGGGG + Intergenic
1171299276 20:24045545-24045567 CTGCATCTGCAGGAGCTCAGAGG + Intergenic
1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG + Intergenic
1172657072 20:36543822-36543844 CTGGAGAAGAAAGAGCACAGGGG + Intronic
1173666918 20:44769650-44769672 CGAGAACAGGAGGAGGACAGCGG - Intronic
1173951456 20:46996848-46996870 CTGGAGCAGGAGGAAGAGAGGGG + Intronic
1174140561 20:48410515-48410537 CTGGAACGGGAGGAGCTCAATGG + Intergenic
1174363143 20:50040886-50040908 CTGGCCCAGGAGGAGCACATGGG - Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175440822 20:58989915-58989937 CTGGCCCAGGAGGAGCAGGGGGG + Exonic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1175979824 20:62732895-62732917 CTGGGCCTGGAGGACCACAGCGG + Intronic
1176152745 20:63600902-63600924 CTGCATCAGGAGGCTCAAAGGGG + Intronic
1176449164 21:6848486-6848508 CCTGATCAGGAGAAGGACAGTGG + Intergenic
1176827332 21:13713510-13713532 CCTGATCAGGAGAAGGACAGTGG + Intergenic
1176840775 21:13841557-13841579 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1177820556 21:26026704-26026726 GTCGAACAGGAGGAACACAGAGG + Intronic
1178210638 21:30527417-30527439 CTGGATTAGGAGGAGAGCGGTGG - Intergenic
1178418479 21:32423921-32423943 CTGGGGCTGGAGGAGCAGAGAGG + Intronic
1178507838 21:33177221-33177243 CTGGAGCAGGAGGAAGAGAGAGG - Intergenic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179772902 21:43636999-43637021 CTGGAACAGGACGAGCGAAGTGG + Intronic
1179816287 21:43908403-43908425 CCCGATCAGGGGGAGCACATGGG + Intronic
1182073449 22:27478909-27478931 ATGGACCAGGAGGAGGACGGTGG + Intergenic
1182453567 22:30435384-30435406 CTGGATAAGGAGGCTCAAAGGGG - Intergenic
1182746126 22:32606765-32606787 CTGAATGAAGAGGAGCAGAGAGG - Intronic
1183024376 22:35053176-35053198 CTGAATCAGGAGGACTCCAGGGG + Intergenic
1183076687 22:35431821-35431843 CTGGAGGAGGAGAGGCACAGAGG - Intergenic
1183185510 22:36289372-36289394 CTGGGGAAGGAGGAGCCCAGAGG + Intronic
1183510284 22:38230625-38230647 CTAGCTCAGGAGGAGCAGGGCGG - Intronic
1183579683 22:38716499-38716521 CTTGAGCCGGAGGAGCACAGTGG - Intronic
1183628218 22:39017705-39017727 CAGGAGCAGGAGGAGTGCAGGGG - Intronic
1184058566 22:42068149-42068171 CTGGGTCAGGGGAAGTACAGGGG + Intronic
1184124345 22:42476462-42476484 ATGAATCAGGCTGAGCACAGTGG - Intergenic
1184430631 22:44439915-44439937 CTGGATCTGCAGGGGCTCAGAGG + Intergenic
1184972556 22:48036805-48036827 GAGGAGCAGGTGGAGCACAGAGG - Intergenic
1185003138 22:48258490-48258512 CTAGGTGATGAGGAGCACAGGGG + Intergenic
1185018246 22:48358182-48358204 CTCGGGCAGGAGGTGCACAGAGG + Intergenic
1185244567 22:49766108-49766130 CGGGATGGGGAGGAGCCCAGTGG + Intergenic
1185416923 22:50715598-50715620 CTGGCTTAGGAGGAGGACTGGGG + Intergenic
950247819 3:11438141-11438163 CTGGAGCAGCAGGACCTCAGGGG - Intronic
952076785 3:29706477-29706499 CTGGAGCAGGAGGTGAAGAGGGG + Intronic
952443415 3:33356633-33356655 CTCGAGCAGGATGGGCACAGTGG - Intronic
953794750 3:45976040-45976062 TTGAATCAGAAGGAGCCCAGGGG + Intronic
954834222 3:53451146-53451168 CTGAATCAGGCTGGGCACAGTGG - Intergenic
956069393 3:65431751-65431773 CTGAGTCAGGTGGAGCACTGAGG + Intronic
956491108 3:69773225-69773247 CTGGACCAGGCTGAGCAAAGTGG + Intronic
957198645 3:77103086-77103108 ATGGAGCAGAAGGAGCACAGGGG + Intronic
957305034 3:78447060-78447082 ATGGTTCAGGATGGGCACAGTGG + Intergenic
958491045 3:94773925-94773947 CTTGAACATGAGGAACACAGTGG + Intergenic
959426890 3:106201404-106201426 CTGGAACAGGAGGAAGACAGTGG - Intergenic
960041205 3:113151591-113151613 CTGGCTCAGCAGGGGCCCAGTGG - Intergenic
960462336 3:117951817-117951839 CTGGATCAGGAGGAAGACAGCGG - Intergenic
961565617 3:127761411-127761433 CTGGAGAAGGAGGAGCCCTGGGG - Intronic
961714218 3:128847639-128847661 CTGGACCAGGTGGGGCAGAGGGG + Intergenic
961819849 3:129570456-129570478 GGGGAGCAGGAGGAGCAGAGAGG - Intronic
962582523 3:136811251-136811273 CTGGATCAGGCTAGGCACAGTGG + Intergenic
963921184 3:150907510-150907532 GTGGAACAGCGGGAGCACAGGGG + Intronic
964791093 3:160453520-160453542 CTGGGTCTGGAGGGGCAGAGGGG - Intronic
967067736 3:185935515-185935537 CTGGAAAAGGTGGGGCACAGAGG + Intronic
967872575 3:194244225-194244247 CATGAACAGGTGGAGCACAGAGG + Intergenic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
968952377 4:3701744-3701766 CTGGGGCAGGAGGCTCACAGAGG - Intergenic
969431104 4:7154776-7154798 CTGGACCAGGTAGAGCAGAGAGG - Intergenic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969669596 4:8582394-8582416 CTGGAACCTGAGGAGGACAGAGG - Intronic
969861531 4:10039648-10039670 TTGGACCAGGAGGATGACAGTGG - Intronic
971264979 4:25089327-25089349 CTGGCTCAGGAGGTGGAGAGAGG - Intergenic
971476743 4:27079800-27079822 CTGCATCAGGCCAAGCACAGTGG - Intergenic
971752768 4:30672383-30672405 TATGAACAGGAGGAGCACAGAGG + Intergenic
973182467 4:47286508-47286530 CTGGCGTAGCAGGAGCACAGGGG - Intronic
975476734 4:74832146-74832168 TTGGATCAGAAAGAGCACATAGG + Intergenic
976119220 4:81761642-81761664 CTGGATGAGGCTGGGCACAGTGG + Intronic
977591374 4:98831353-98831375 CTGGGTCAGGCTGGGCACAGTGG - Intergenic
978534161 4:109743717-109743739 CTAGATCAGGCTGGGCACAGTGG + Intronic
982718613 4:158836512-158836534 ATTGATCAGGCCGAGCACAGTGG + Intronic
983222179 4:165053926-165053948 CTGGAGCAGGGGGAGCTCTGCGG - Intergenic
983647519 4:170006842-170006864 CTAGATGAGGTGGAGCTCAGAGG - Intronic
984019964 4:174473741-174473763 CTGGACCCGGAGGAGCAAAGGGG + Intergenic
984844365 4:184097467-184097489 CTGGGTCAGTCGGAGCGCAGAGG - Intronic
984855485 4:184191557-184191579 GTGGATCAGGACCAGAACAGAGG - Intronic
984951335 4:185009973-185009995 CTGGACCAGGAGGGGCACAGGGG - Intergenic
988483281 5:31647182-31647204 CTGGATCCTGAAGAGTACAGGGG - Intronic
988920196 5:35934417-35934439 ATGGATCAGGAGAAGCACACAGG - Intronic
989154154 5:38328205-38328227 CCAGAGCAGGAGGAACACAGGGG + Intronic
991172582 5:63646018-63646040 CTGGAGCAGGAGGAAGACAGAGG + Intergenic
992622989 5:78611578-78611600 CTGGGGCAGAAGGAGCCCAGAGG + Intronic
992635920 5:78725970-78725992 ATGGAGCAGAAGGGGCACAGAGG + Intronic
992843093 5:80715727-80715749 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
993344827 5:86769840-86769862 CTGGAGCAGGAGGAAAAGAGAGG + Intergenic
993476542 5:88373300-88373322 GTTGATTAGGAGAAGCACAGGGG + Intergenic
993804750 5:92391661-92391683 GATGAACAGGAGGAGCACAGAGG + Intergenic
994145083 5:96385712-96385734 ATGGAGCAGAAGGAGCAGAGTGG + Intergenic
994245011 5:97468612-97468634 CTGGATAGGGAGGAGCAGAGGGG + Intergenic
994558725 5:101339066-101339088 CTGGACCAGGAGGAAGAAAGAGG + Intergenic
995030736 5:107478169-107478191 CTGGATCAGGAGGAGAAGCAGGG - Intronic
995154531 5:108894649-108894671 CTGGACCAGAAAGAGGACAGGGG + Intronic
995564768 5:113422675-113422697 CTGGACCTGGATGAGCCCAGTGG + Intronic
996232966 5:121088501-121088523 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
996674586 5:126159232-126159254 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
997579428 5:135007997-135008019 GAAGAGCAGGAGGAGCACAGAGG - Exonic
997868702 5:137488087-137488109 CTGGATTGGGCTGAGCACAGTGG + Intronic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
998387515 5:141766259-141766281 CTGGATATGGGGCAGCACAGGGG - Intergenic
999435474 5:151559941-151559963 CTGGATGAGGTGGCGCTCAGTGG + Intronic
999798378 5:155009278-155009300 CTGGATCATGAGGAGGGCAGGGG - Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001276129 5:170353079-170353101 CTGGAGCAGGAGGTGGTCAGGGG + Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002196432 5:177504077-177504099 CTGGATCAGGTGGAGGGCACAGG - Exonic
1003818056 6:9863759-9863781 CTGGAGCAGGAGGAAGAGAGTGG + Intronic
1006116811 6:31779979-31780001 CTTGGTGAGAAGGAGCACAGCGG - Exonic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1007163677 6:39812763-39812785 CAGGAGCTGGAGGAGGACAGAGG - Intronic
1011698383 6:89933387-89933409 GTTGAACAGGTGGAGCACAGAGG + Intronic
1013609150 6:111778072-111778094 CTGGCCCACGAGGAGCACAGAGG - Intronic
1013812908 6:114064848-114064870 CTGGAGGAGGAGGAGCAAGGAGG + Intronic
1014711913 6:124816289-124816311 GATGATTAGGAGGAGCACAGGGG + Intronic
1014756265 6:125304484-125304506 ATGAATCAGGAGGAGCTCAAAGG - Intergenic
1014933330 6:127359520-127359542 CTGGATCAGGTGGGGCGCAGTGG - Intergenic
1015240465 6:131017242-131017264 CTGGACTAGGAGCAGCTCAGTGG + Intronic
1015373347 6:132481007-132481029 CTGAAAGAGGAGGAGCACACAGG + Intronic
1015395691 6:132732051-132732073 CTGAAGCAGGAGGATCACTGGGG - Intronic
1015559421 6:134498451-134498473 CTGGGTGAGGAGGAGGACACTGG + Intergenic
1016720616 6:147292787-147292809 CTGGAACAGGTGAAGCACAGAGG - Intronic
1017720707 6:157241224-157241246 CAGGCTCGGGAGGAGCACTGCGG + Intergenic
1017885998 6:158599862-158599884 CTGGCCCAGGAGGAGCACGCAGG + Intronic
1017989316 6:159472396-159472418 CTGGATCAGGAGGAAGAGAGAGG + Intergenic
1018705038 6:166457803-166457825 CTGAATCTGGAGGAACAAAGTGG + Intronic
1018766312 6:166935958-166935980 CTGGAACAGGCTGGGCACAGTGG - Intronic
1019117779 6:169779196-169779218 CAGTATCAGGCTGAGCACAGGGG - Exonic
1019392169 7:794738-794760 CGGGGGCAGGAGGAGCCCAGAGG + Intergenic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020906985 7:14075611-14075633 ATGGATCAGATGGACCACAGAGG + Intergenic
1021089233 7:16462781-16462803 CTGGAGCAGGAGGAGCTCCCAGG - Exonic
1021689997 7:23222401-23222423 CAGGATCAGAAGTTGCACAGAGG + Intergenic
1022480080 7:30737372-30737394 AATGATCAGGTGGAGCACAGAGG - Intronic
1022561918 7:31358329-31358351 ATGGATCAGAAAGAGCAAAGCGG - Intergenic
1024430200 7:49279646-49279668 CTTGAAGATGAGGAGCACAGTGG - Intergenic
1028254088 7:88570769-88570791 GTTGATTAGGTGGAGCACAGAGG - Intergenic
1029272200 7:99384028-99384050 CTGGAAGTGGAGGAGCCCAGTGG - Intronic
1029644572 7:101845727-101845749 CAGGATCTGGCCGAGCACAGAGG + Intronic
1032442785 7:131954947-131954969 GGGGAACAGGAGGACCACAGGGG - Intergenic
1033078608 7:138272771-138272793 CTGGAGCAGGAGGAACAGTGGGG + Intergenic
1034474299 7:151273871-151273893 CTGGAGGAGGAGGGGCACTGGGG + Intronic
1034834309 7:154337604-154337626 CTGGGTAAGGAGGCACACAGAGG - Intronic
1034855989 7:154547919-154547941 GTGGATGAGGCTGAGCACAGTGG + Intronic
1035216624 7:157372431-157372453 CTGAGTGAGGAGGAGCACAGCGG + Intronic
1035554034 8:551693-551715 CTTGAAGATGAGGAGCACAGTGG + Intergenic
1035769374 8:2134627-2134649 CTGAATGAGGAGATGCACAGAGG - Intronic
1035827634 8:2661401-2661423 CTGGATTAGGAGGAGGACTAAGG + Intergenic
1036410150 8:8492397-8492419 CAGTGTCAGGAGGAGGACAGAGG + Intergenic
1036913713 8:12784429-12784451 CTGGAGCAGGAGGAAGAAAGGGG - Intergenic
1037319971 8:17632731-17632753 CTGGATGGGGAGGAGGACAGAGG - Intronic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1038740620 8:30213520-30213542 CAGGATGAGACGGAGCACAGAGG - Intergenic
1039562569 8:38524618-38524640 CTGAATCCGGAGGAGAAAAGGGG - Intronic
1040076886 8:43246327-43246349 CTGGCAGAGGAGGAGCAGAGCGG + Intergenic
1041044358 8:53877475-53877497 CTCGCTCGGGAGGAGGACAGGGG - Intronic
1041149749 8:54919265-54919287 CAGGGTCAGGAGCAGAACAGAGG - Intergenic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1044250453 8:89999682-89999704 CTGGAGCAGGAGGAAGAGAGAGG + Intronic
1045094535 8:98784261-98784283 CTGGCTCTGGAGCAGGACAGAGG + Intronic
1049255686 8:141612424-141612446 GTGCACCAGGAGGAGCTCAGAGG - Intergenic
1049397647 8:142409043-142409065 CTGCATCAGGGGGAGAATAGGGG - Intergenic
1051124664 9:13790862-13790884 CTGAATGAGGCAGAGCACAGTGG + Intergenic
1051921500 9:22271961-22271983 CTGGAGCAGGAGGAAGAAAGGGG - Intergenic
1055610610 9:78020530-78020552 CTGGGTGAGGAAGGGCACAGTGG + Intronic
1056749578 9:89337960-89337982 CTGGATGAGGAGAGGCCCAGGGG + Intronic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1058853601 9:109037584-109037606 CTGGAGCAGGAGGAAGAGAGGGG - Intronic
1058974769 9:110115502-110115524 CTGGATCAGGACAGGCACTGGGG - Intronic
1059173373 9:112147405-112147427 CTGAGACAGGAGAAGCACAGGGG + Intronic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1059603637 9:115809189-115809211 AGGGATCCGGGGGAGCACAGGGG + Intergenic
1060410364 9:123396043-123396065 CCAGATCAGGAGACGCACAGGGG + Intronic
1060527721 9:124329866-124329888 GTGACTCAGGAGGGGCACAGGGG + Intronic
1060917276 9:127398615-127398637 CTGGGTCAGGAGGGGGAAAGGGG - Intronic
1061398884 9:130357778-130357800 CAGAATCAGGAGGAGTACAGTGG - Intronic
1203773861 EBV:62206-62228 GTGGAGCTGGTGGAGCACAGTGG - Intergenic
1203520024 Un_GL000213v1:36030-36052 CCTGATCAGGAGAAGGACAGTGG - Intergenic
1185520142 X:732508-732530 CTGGAGCAGGCTGGGCACAGTGG + Intergenic
1187586109 X:20663588-20663610 CTGGTTAAGGAGGAGAAGAGAGG - Intergenic
1188675778 X:32937322-32937344 CTGCAGCAGGAGGAGTACAGTGG - Intronic
1190446074 X:50525783-50525805 CTGGAGCAGGAGGAAGAGAGAGG + Intergenic
1193468470 X:81873407-81873429 CTGGGTAAGGAGGAGCTGAGGGG + Intergenic
1193574756 X:83184050-83184072 CTGGATAGGGAGGAGCAAAGGGG + Intergenic
1193615394 X:83681831-83681853 CTGTAAGAAGAGGAGCACAGAGG - Intergenic
1195127415 X:101822281-101822303 CTGGGCCAGGAGCAGCAAAGCGG - Intergenic
1195562964 X:106305844-106305866 CTTAATGATGAGGAGCACAGTGG + Intergenic
1195935998 X:110126271-110126293 CTGGATCAGGAGGAGAGGGGTGG - Intronic
1196679096 X:118452620-118452642 CTGGAGCACATGGAGCACAGTGG - Intergenic
1197893709 X:131289249-131289271 CTGCATCTGGAGGAGCTCACTGG - Exonic
1198083033 X:133257061-133257083 CCGGAGCAGGAGGAAGACAGGGG - Intergenic
1199385319 X:147216679-147216701 CTAGAACAGGAGGAAAACAGAGG - Intergenic
1200273107 X:154706126-154706148 CTGGATCTGGCCGGGCACAGTGG + Intronic
1200908303 Y:8508377-8508399 CTGGTCCAGGCTGAGCACAGTGG - Intergenic
1202198847 Y:22326036-22326058 CTGGTTCAGGCTGAGCACAGTGG - Intronic