ID: 1120107987

View in Genome Browser
Species Human (GRCh38)
Location 14:80517978-80518000
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 29, 1: 90, 2: 112, 3: 84, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120107977_1120107987 24 Left 1120107977 14:80517931-80517953 CCCTGCCAGATCCAGAGGGGTGG 0: 10
1: 46
2: 99
3: 132
4: 299
Right 1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG 0: 29
1: 90
2: 112
3: 84
4: 319
1120107982_1120107987 13 Left 1120107982 14:80517942-80517964 CCAGAGGGGTGGAAGTCAGTGGC 0: 20
1: 67
2: 87
3: 104
4: 238
Right 1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG 0: 29
1: 90
2: 112
3: 84
4: 319
1120107979_1120107987 23 Left 1120107979 14:80517932-80517954 CCTGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG 0: 29
1: 90
2: 112
3: 84
4: 319
1120107980_1120107987 19 Left 1120107980 14:80517936-80517958 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG 0: 29
1: 90
2: 112
3: 84
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
905937002 1:41832653-41832675 CAGCACAAAGCAGTGGTGCCTGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
907716967 1:56934914-56934936 CAGCAAACCCCAGTGCTGGTAGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
908930885 1:69315132-69315154 CAGATGCCAGCAGTGGTGGATGG + Intergenic
909914011 1:81295323-81295345 AAACAAACAGGAGTGGTAGAAGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910354219 1:86336826-86336848 CAGAAAACAGAAGTGGAGGCAGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
915902908 1:159858898-159858920 CAGCAGACAGCAGTGCTAGGGGG + Exonic
916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067509277 10:46881920-46881942 CAGAAAACAGCGGTGATGGCAGG + Intergenic
1067652975 10:48169935-48169957 CAGAAAACAGCGGTGATGGCAGG - Intronic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069735433 10:70650868-70650890 CAGCAAACAGTAGTAATGGGTGG - Intergenic
1070400944 10:76053090-76053112 TATCAAACAGCAATGGTTGAAGG - Intronic
1070604896 10:77891839-77891861 CAGCAAGCAGCAGAGCCGGATGG - Intronic
1070829751 10:79411093-79411115 CAGCAGGCAACAGTGATGGATGG + Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073453046 10:103620590-103620612 CTGCAAACAGCAGAGCTGGTCGG - Intronic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075220919 10:120583872-120583894 CAGGAAACACCACTGGTGGTAGG + Intronic
1075733302 10:124649028-124649050 CAGGCAACAGCAGCAGTGGAAGG + Intronic
1076036454 10:127202382-127202404 CAGCACACAGCGCTGGTGGGTGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076631817 10:131856253-131856275 CAGCGAACAGCACAGGTGGGTGG + Intergenic
1076927738 10:133501652-133501674 AAGCAAACAGAGGTGTTGGAGGG + Intergenic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1078630337 11:12997302-12997324 CAGCAAACAATAGAGCTGGAGGG - Intergenic
1078692812 11:13598784-13598806 CAGCAAACCCCAGTGGGAGATGG - Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081063030 11:38503995-38504017 CCACAATCAGCAGTGGGGGATGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081905639 11:46667790-46667812 TATCAAACAGCAGTGAGGGACGG + Exonic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1084599679 11:70137426-70137448 CAGCAGACAGCGGTGATGGCGGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1086058305 11:82674398-82674420 CAGGCAACAGAAGTGATGGATGG + Intergenic
1086064362 11:82731297-82731319 CAGAAACCAACAGAGGTGGAAGG + Exonic
1086327777 11:85722030-85722052 AAGCAAACTGCAGTGGGGGTGGG - Intronic
1086573823 11:88315214-88315236 CCTCAAACAGCAGAGGTGGGAGG - Intronic
1086777263 11:90853979-90854001 GAGCAAACAGAAGGGCTGGATGG - Intergenic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087686675 11:101273149-101273171 CAGCAAGCAGAAGAGGTGGGGGG - Intergenic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088606580 11:111539546-111539568 CAGCTAACAGCGGTTGTGGCAGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089627577 11:119761435-119761457 CAGCAGACAGAGGTGGTGGGAGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1090615164 11:128507587-128507609 CAGCAAACCCCAGAGGTGCATGG + Intronic
1090855452 11:130606667-130606689 AAGCAAAGAGCAGAGGTGAAGGG - Intergenic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091639741 12:2227054-2227076 CATCACCCAGCAGTTGTGGAGGG - Intronic
1093053557 12:14532412-14532434 CAGCATGCAGCAGGGGAGGACGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1097075102 12:56387203-56387225 CAGCACACAGCAAGAGTGGAAGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1100816913 12:98395662-98395684 CACCAAAGAAGAGTGGTGGAGGG + Intergenic
1101012667 12:100467196-100467218 CAGCTGACTGCAGGGGTGGATGG + Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1102535175 12:113575849-113575871 CATCAAACAGCAGTGCAAGAAGG - Intergenic
1102833045 12:116025066-116025088 CAGAACAAAGCAGTGGTGGGGGG - Intronic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1106895845 13:34301552-34301574 CAAGAAACATCAGTGGAGGAAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114896256 14:26994545-26994567 CAGAAAACAACAGAGGTGGCTGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116012379 14:39366581-39366603 CAGATGCCAGCAGTGGTGGATGG + Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1116870362 14:50064132-50064154 CAGCTACCAGGAGTGCTGGAGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118135299 14:63018435-63018457 CAGCAGACAGCAATGGTAAAGGG + Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119623023 14:76147155-76147177 AAGCAGGCAGCAGTGGAGGAGGG - Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121423052 14:93829268-93829290 CAGCAAACAGCGGTTCAGGAAGG - Intergenic
1121732914 14:96198634-96198656 CAGCAACCCCCAGAGGTGGAGGG + Intergenic
1122764065 14:104053097-104053119 CACCAAGCAGCTGTGGTGGCTGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123736015 15:23183737-23183759 CAGCAAACAGCAGTAGTAAGAGG - Intergenic
1123982744 15:25619029-25619051 CAGCAAACTGCAGCTGTGGGAGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125747196 15:42005080-42005102 CAGCAGGCAGCTGTGGGGGAAGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127027006 15:54817839-54817861 CAGCAGAAAGCAGAGGTCGAAGG - Intergenic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127659650 15:61088457-61088479 AAGCAAAAAGCGGTGGGGGATGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128685033 15:69677759-69677781 CAAAAAACTGCAGTGGTGTAAGG - Intergenic
1129236630 15:74227596-74227618 TAGCCAACAGCAGTGGTTCAGGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129799742 15:78405346-78405368 CAGCAGGCTGCAGTGGTGGTGGG - Intergenic
1129882574 15:79016929-79016951 CAGCCAACAGCAGAAGGGGAGGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132214283 15:100051231-100051253 CAGCAAGCAGCAGCAGTTGAAGG + Intronic
1132405485 15:101539767-101539789 CAGCAAGCAGCCTTCGTGGAAGG + Intergenic
1132406756 15:101546381-101546403 AAGCAACAAGCAGTGATGGAGGG + Intergenic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134224205 16:12379086-12379108 CAGGAAACAGGAGTGGAGTATGG - Intronic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1135068916 16:19335341-19335363 CAGGAACCAGAAGGGGTGGACGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG + Intergenic
1136961065 16:34848093-34848115 CTGCAAAAAGCAGCGGTGGTGGG - Intergenic
1138153921 16:54685673-54685695 AAGAAGACAGCAGTGGTGCAGGG - Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141617089 16:85216029-85216051 CAGCCAACAGGAGTTGGGGAGGG + Intergenic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143513122 17:7406622-7406644 CAGCAAACAGCTCTGGCGGCTGG + Intronic
1144068512 17:11645823-11645845 CACCTAATAGCAGAGGTGGAAGG - Intronic
1144433015 17:15212507-15212529 CAGCAAGCTGCAGGGGTGAAGGG + Intergenic
1145694161 17:26774347-26774369 CAGCAAAAAGCCGCGGTGGTGGG - Intergenic
1145978214 17:28996444-28996466 CAGCAAACCTGAGTGGGGGAGGG + Intronic
1146375836 17:32293804-32293826 AAGCAAACAGAAGTGGGTGAGGG + Intronic
1147710496 17:42460129-42460151 CAGAAAGCTGCAGAGGTGGAAGG + Intronic
1148083038 17:44977860-44977882 CAGCAGGCAGGAGAGGTGGAGGG + Intergenic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148988388 17:51644294-51644316 CAGCAAACTGAGGTGGTGCAGGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150930686 17:69581496-69581518 CTGCAAACAGGTGTGCTGGAGGG - Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1151940309 17:77287841-77287863 CAGGAAACAGGAGTGGCGCAGGG + Intronic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152242120 17:79166212-79166234 AAGCAAACACCAGTGTGGGAGGG + Intronic
1153056267 18:949613-949635 CAGATGCCAGCAGTGGTGGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154169015 18:12037425-12037447 CAGCAAAATGGAGTGGTGGGAGG - Intergenic
1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156257044 18:35408807-35408829 CAGCACACAGCAGGCATGGAGGG - Intergenic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158574274 18:58623087-58623109 CAGAAAAAAGCAGTGGTGTGAGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1161551697 19:4916593-4916615 CAGCACACAGGACGGGTGGAGGG - Intronic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164856395 19:31527868-31527890 CAGCAAAATGCAGTTGTAGAGGG - Intergenic
1164856444 19:31528310-31528332 GAGCAAACAGAACTTGTGGAAGG + Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1166027177 19:40097577-40097599 CAGAAGACACCAGTGGTTGATGG + Intergenic
1167192740 19:48003017-48003039 CAAGAAACAGCAGCGGTGGCAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202680270 1_KI270712v1_random:2949-2971 CAGCAAAAAGCCGCGGTGGCGGG + Intergenic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926599797 2:14830188-14830210 CAGCAATGAGCAGAGGTAGAGGG + Intergenic
926884897 2:17588022-17588044 CACAAAACAGGACTGGTGGAAGG - Intronic
927339300 2:21963332-21963354 CAGCAACCAACAGAGATGGAAGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928674557 2:33637542-33637564 CAGCCAAATGCAGTGGTGGCAGG + Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
928990496 2:37228340-37228362 CAGCAAACAGCAGTGCCTTATGG - Exonic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
932560509 2:72863351-72863373 CAGCAAACAGGAGACGTGGCTGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933940173 2:87238683-87238705 CTGCAACCAGCAGGGGTGAAAGG - Intergenic
934331661 2:92074448-92074470 CCGCAAAAAGCAGCGGTGGTGGG - Intergenic
935316082 2:101835468-101835490 CAACAAACAGCATTTCTGGAGGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG + Intergenic
936428084 2:112436235-112436257 GAACAAACAGCAGGGGTGGGGGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
937903833 2:127042080-127042102 CAAGAAGCAGCTGTGGTGGATGG - Intergenic
938479352 2:131646790-131646812 CAGCAAACACCAGCGGTTTATGG + Intergenic
939067121 2:137496944-137496966 CAGCAAATTGCAGAAGTGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940284699 2:152022315-152022337 CATCAAGGAGAAGTGGTGGAGGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945394995 2:209306584-209306606 AACAAACCAGCAGTGGTGGATGG - Intergenic
945834118 2:214818945-214818967 TAGCACACACCACTGGTGGATGG - Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1170766968 20:19298548-19298570 CAGGAAACAACAGTAGAGGATGG + Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171343907 20:24451523-24451545 CAGGCAGCAGCAGTGGTGAATGG - Intergenic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173088564 20:39948636-39948658 GAGCAAACAGAATGGGTGGAAGG - Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1175657449 20:60783766-60783788 CAGGAAACAGCTGTGAAGGAAGG - Intergenic
1175758742 20:61546966-61546988 AAGCAGACAGCAGTGATGGGCGG + Intronic
1176374169 21:6078976-6078998 GAACAAACAGCAGGGGTGGGAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177829821 21:26125511-26125533 CAGTAAACAGGAGTGGAGGTAGG + Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178664842 21:34537592-34537614 CAGCAGCCATCATTGGTGGAGGG - Intronic
1178812489 21:35896841-35896863 CATCAAACAGTAATGGTGAAAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1179749308 21:43459269-43459291 GAACAAACAGCAGGGGTGGGAGG - Intergenic
1179840570 21:44070278-44070300 CAGCAATCAGGAGAGGAGGAGGG + Intronic
1180632196 22:17237385-17237407 CAGAAAACAGGAGAGGAGGAGGG + Intergenic
1180839421 22:18952217-18952239 CAGCAACCTGCAGGGGTGGGTGG + Intergenic
1181062479 22:20288267-20288289 CAGCAACCTGCAGGGGTGGGTGG - Intergenic
1181141172 22:20806032-20806054 CAACACACAGCAGGGGTGGTGGG + Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182204965 22:28614675-28614697 CAGCAACAAGCAATGGGGGAAGG + Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1184072506 22:42154769-42154791 CAGCAAACATGGGTGGTGGGTGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953766505 3:45747262-45747284 CACCAACAAGCACTGGTGGAGGG + Intergenic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954130958 3:48560771-48560793 CAGCAAAGAGCAGAGCAGGAGGG + Intronic
954619103 3:51985672-51985694 CAGGAGACAGCAATGGGGGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955908122 3:63829302-63829324 CACCATACAGCAGTGGGGTAAGG + Intronic
956612327 3:71136669-71136691 CAGCAAAAAACAGTTGTTGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959406341 3:105966161-105966183 CAGCGATCGGCAGTGGTTGACGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963315967 3:143759182-143759204 CAGGAAATAGCAGTGTTAGATGG - Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963822005 3:149907683-149907705 CAGCATATAGCATTGCTGGAAGG + Intronic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
965113041 3:164451556-164451578 CAACAAATAGCAGGGGTGGGTGG + Intergenic
965116369 3:164494901-164494923 CAGCAAACAGCAAGGGTAAAAGG - Intergenic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970049255 4:11895163-11895185 CATCGCAGAGCAGTGGTGGAAGG - Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982513066 4:156308571-156308593 CATCAAAAAGCAGTTGTGAAAGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984595859 4:181667361-181667383 AAACAAACAGCAGTAGTGGTAGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985622797 5:964375-964397 GAGCAAACAGCACAGGTGCATGG + Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987572932 5:19688000-19688022 CAGGTGCCAGCAGTGGTGGATGG - Intronic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988456742 5:31393686-31393708 CAGCAGACAGCAGGACTGGAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988863506 5:35309026-35309048 CATCACACAGCAGGGATGGAAGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991772557 5:70053350-70053372 CAGGAAACAGCACTTGGGGATGG + Intronic
991851850 5:70928774-70928796 CAGGAAACAGCACTTGGGGATGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992392071 5:76338533-76338555 CAGCAGACTGCAGTGGGGGTGGG - Intronic
992980524 5:82166333-82166355 CAACACAAAGCAGTGGTGGTGGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997405414 5:133642419-133642441 CAGCTCACAGAAGTGTTGGAGGG - Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
998078910 5:139258587-139258609 CAGGAACCAGCCTTGGTGGAGGG + Intronic
998290662 5:140911034-140911056 AAGCAAACAGGGGTGGTGGGGGG + Intronic
998467952 5:142360953-142360975 CAGCAAACAAGAGCGGAGGAGGG + Intergenic
998939787 5:147268990-147269012 CAGTAAAGAACAGTGTTGGAGGG + Intronic
1000187014 5:158869041-158869063 CAGAAAACACCAGTCCTGGACGG - Intronic
1002683535 5:180988971-180988993 CAGATGACAGCAGGGGTGGATGG - Exonic
1002919203 6:1554365-1554387 CAGCAGACACCAGTGGCGTAGGG - Intergenic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004354636 6:14920427-14920449 CAGCAGACACCAGAGCTGGAAGG + Intergenic
1004662665 6:17723865-17723887 CAGCAGCCAGAAGTGGTGGCGGG + Intergenic
1004978844 6:20999322-20999344 CAGCATGCAGCAGTGGAGAAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006511123 6:34521709-34521731 CAGGCAACGGCGGTGGTGGATGG + Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011193935 6:84763635-84763657 CAGCAAACAGCCGCGGCCGAAGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012666871 6:101982158-101982180 CAGCAAATAGAATTGGTGGGTGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013362090 6:109403415-109403437 CAGTAAACAGCACTGCTGAAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1019135929 6:169907711-169907733 CAGCAGGAAGCAGTGGAGGAAGG + Intergenic
1019641324 7:2105323-2105345 CAGCTAAGAGCAGGGGAGGAAGG + Intronic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1020685502 7:11288861-11288883 CTGCAAACAGCAGCAGTAGATGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023169592 7:37377751-37377773 TAGCAAACAGCCTTGGAGGAGGG - Intronic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023466978 7:40466729-40466751 CAGAAAAGAGCAGTGGTAGCTGG + Intronic
1023665378 7:42517722-42517744 CAACAAAGAGGAGTGGTAGATGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024366599 7:48527443-48527465 CAGAAAACAGCTGTCTTGGAAGG + Intronic
1024470774 7:49767194-49767216 CAGCAGAAAGCAGTGCAGGAAGG - Intergenic
1025041388 7:55648986-55649008 CAGTAAACATCAGTAGTGAAGGG - Intergenic
1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG + Intergenic
1025320207 7:58087328-58087350 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028811611 7:95094426-95094448 CAGGAAACAGCACTGGAAGACGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029677653 7:102081539-102081561 CAGGAAACAGTTGTGGCGGAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032187473 7:129739588-129739610 CAGTAAACAGCAGGGTGGGAGGG + Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1032851552 7:135799545-135799567 CTGAAAACAGGAGTGGAGGATGG - Intergenic
1033129432 7:138733239-138733261 CAGCAAACAGCAATCCTGTATGG + Intronic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034950084 7:155291094-155291116 CAGCAGATAGCAGTGGCAGAGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035022408 7:155807416-155807438 GAGCAAACTGAAGAGGTGGAGGG + Intronic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1041096069 8:54351456-54351478 AAGCAAACAGTATGGGTGGAGGG - Intergenic
1041144061 8:54853325-54853347 CAGGAAGCAGCAGTGAAGGAAGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041725014 8:61010150-61010172 CAGCAACAAGCAGAGGTGAATGG - Intergenic
1041766822 8:61427474-61427496 CAGTAAACAGCAGTTGTATAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042083179 8:65078254-65078276 CAGCAAAGAGCAGAAGTGAAAGG + Intergenic
1042361280 8:67885861-67885883 CAGCAAGCAGCAGTGGAGTTTGG - Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044381508 8:91539581-91539603 AAACAAACAGCACTGGGGGATGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048183260 8:132215625-132215647 CAACAAACAGCAGTGGGTGCAGG - Intronic
1048496452 8:134939859-134939881 AAGTAAACAGCAGTGGAGGGAGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049566871 8:143344807-143344829 CACCAAACAGCGGAGGAGGAGGG + Intronic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1050616818 9:7409897-7409919 CAGCATAAAGTAGTGGTGTAGGG + Intergenic
1050813350 9:9778133-9778155 AAACAAAAAGCTGTGGTGGATGG + Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1050899907 9:10934127-10934149 CAGCCACCAGCAGGAGTGGAGGG + Intergenic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053535337 9:38920086-38920108 CAGCAAACTGTAGTGCTTGAGGG - Intergenic
1053946177 9:43311929-43311951 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1054207558 9:62144490-62144512 CAGCAAACTGTAGTGCTTGAGGG - Intergenic
1054630794 9:67443864-67443886 CAGCAAACTGTAGTGCTTGAGGG + Intergenic
1055352095 9:75400020-75400042 CACAAAACAGCACTGGGGGATGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055988016 9:82073086-82073108 CAACAGACACCAATGGTGGAGGG + Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056577106 9:87864088-87864110 CACCAAACAGCAGGGATGAAGGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1057744104 9:97737937-97737959 CTGCAAACAGCAGCTGAGGATGG - Intergenic
1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG + Intergenic
1059674792 9:116527883-116527905 AAGCTTACAGTAGTGGTGGAAGG - Intronic
1061887880 9:133601932-133601954 CAGCACACAGGAGTGCTGCAGGG + Intergenic
1061928856 9:133821902-133821924 CAGAAAACAGCAGGAGTGAAAGG - Intronic
1203589307 Un_KI270747v1:40487-40509 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1203612989 Un_KI270749v1:27065-27087 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1185917043 X:4047223-4047245 CAACAAAGAGAAGTGGTGTATGG + Intergenic
1187366279 X:18668064-18668086 CAGAAAATAGCATTGTTGGAAGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188319580 X:28719843-28719865 CAGCACACAGGAATGGGGGATGG + Intronic
1188599530 X:31944624-31944646 AAACAAACAGGAGTGGTGGCGGG - Intronic
1188679707 X:32987373-32987395 CATCAATCAGAAGTGGTGTAGGG - Intronic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1190640681 X:52481117-52481139 CATAAAACAGCAGTTCTGGAAGG - Intergenic
1190646991 X:52531748-52531770 CATAAAACAGCAGTTCTGGAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192065415 X:67879908-67879930 CAATAAGCAGCAGTGGTAGATGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193010473 X:76669818-76669840 TAGCAAACTGCAGTACTGGAGGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193211200 X:78809126-78809148 CTGCAAGCAGAAGTGGTGGTGGG - Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194641312 X:96406779-96406801 CAGCATACATGAGTGGTGAAAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195831195 X:109060901-109060923 CAGCATCCAGCAGTGGTGCCTGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198241720 X:134794360-134794382 CATCAAACAGCAGTGTTCAAAGG - Intronic
1198605383 X:138331690-138331712 CAGCAATCAGCCTTGGTGAATGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200327742 X:155260313-155260335 CAGCAAACACCTTTGGTGCAGGG + Exonic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1200941260 Y:8784135-8784157 CAACAACCAGCCGTGGTTGATGG - Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic