ID: 1120108776

View in Genome Browser
Species Human (GRCh38)
Location 14:80527889-80527911
Sequence CTTCATTTCTTGGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120108768_1120108776 6 Left 1120108768 14:80527860-80527882 CCAGGCCTGCCTTTTTTCTTTTT 0: 1
1: 10
2: 192
3: 2238
4: 12751
Right 1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 326
1120108770_1120108776 -3 Left 1120108770 14:80527869-80527891 CCTTTTTTCTTTTTTTTCCTCTT 0: 1
1: 14
2: 268
3: 2816
4: 37206
Right 1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 326
1120108769_1120108776 1 Left 1120108769 14:80527865-80527887 CCTGCCTTTTTTCTTTTTTTTCC 0: 1
1: 28
2: 261
3: 4064
4: 19121
Right 1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG 0: 1
1: 0
2: 3
3: 34
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120108776 Original CRISPR CTTCATTTCTTGGGGGAAGA AGG Intronic
902743270 1:18455313-18455335 CTTTATTTCTGGGGGCAAGTGGG - Intergenic
903183561 1:21617475-21617497 CTTCAGGTCTTGGGGCGAGAAGG - Exonic
903321494 1:22546060-22546082 TTGCCTTTCCTGGGGGAAGAGGG - Intergenic
906108525 1:43308567-43308589 CTTCATATGATGGGGCAAGAGGG + Intronic
906529552 1:46515709-46515731 CTTCCCTTCTTGTGGGCAGAGGG + Intergenic
906559666 1:46747152-46747174 GTTCACTGCTTTGGGGAAGATGG + Intergenic
908098691 1:60768013-60768035 CTCCTTTTCTGGGGGAAAGAAGG + Intergenic
908326975 1:63032407-63032429 CGTCACTTCTTGAGGCAAGAGGG - Intergenic
908896984 1:68911793-68911815 ATTCATTGGTTGGGGCAAGAAGG - Intergenic
910158890 1:84252684-84252706 CCTCATTGCATGGGGGAAAAGGG + Intergenic
912682073 1:111735687-111735709 CTTCAGATCTTGGGGCAAAAAGG - Intronic
914202400 1:145497579-145497601 CTTGATTTAATGGGGAAAGACGG + Intergenic
914236332 1:145815503-145815525 CTTGATTTAATGGGGAAAGACGG + Intronic
914481524 1:148070729-148070751 CTTGATTTAATGGGGAAAGACGG + Intergenic
915451652 1:156009502-156009524 CTGGATTTCTTGGGAGAGGAGGG + Exonic
916005722 1:160658348-160658370 CTTCATATCTAGGGGCAAGAAGG + Intergenic
916058612 1:161084499-161084521 CTTCAAGTCTTGGGGTAAGGTGG - Intronic
916215099 1:162387200-162387222 ATCCCTTTCTTGGTGGAAGAGGG - Intergenic
916444555 1:164860202-164860224 CTGCATGACTTGGGGGAAGGTGG - Intronic
916456519 1:164976595-164976617 CTCCATTTCTTGTGGCTAGACGG + Intergenic
916755669 1:167767933-167767955 TCTTATTTCTTGGGGGCAGAAGG - Intronic
917108063 1:171515080-171515102 CATCATTCCTTGGGGGAAAGGGG - Intronic
918232590 1:182549680-182549702 CTTTTTTTTTTGGTGGAAGATGG - Intronic
918681365 1:187358521-187358543 CTTCATTTTTTGGAGGAGGCAGG + Intergenic
920758394 1:208757862-208757884 ATTCATTTCATGGGGTAGGAAGG + Intergenic
921217907 1:212952232-212952254 AATCATTTGCTGGGGGAAGAGGG - Intronic
921934014 1:220779397-220779419 CTCCATTTCTTTGGGTAAAATGG + Intronic
924662541 1:246034954-246034976 CTGCATATATTGGGGGAGGAAGG - Intronic
1063979744 10:11443995-11444017 CTGCATTCCTGGGGGGCAGAGGG + Intergenic
1064052472 10:12069962-12069984 CTGCATTGCTTGGGAGAAGTGGG + Intronic
1065739619 10:28785075-28785097 CTTCCCTTCTTGTGGGAAAAGGG + Intergenic
1066147234 10:32573724-32573746 CAACATTTCTAGGGGGAAAAAGG - Intronic
1066680041 10:37929460-37929482 CTTCATTTCTGAGAGGCAGAGGG - Intergenic
1068973707 10:62985780-62985802 TTTCATATCTTAGGAGAAGAAGG + Intergenic
1069083268 10:64111068-64111090 TTTCATTTCATGGGGGGAGGTGG + Intergenic
1069524657 10:69158578-69158600 TATCATTTCTTGGGGGGAGGGGG + Intronic
1070073818 10:73115788-73115810 GTTTAGTTCTTGGGGGAAGGGGG - Intronic
1070268216 10:74925411-74925433 CTTCACTTGTGGGGGGAAAAAGG - Intronic
1071397682 10:85239302-85239324 TGTCATTAATTGGGGGAAGAAGG - Intergenic
1072156822 10:92731178-92731200 CTTCTTTTTTTGGGGGAGGCAGG + Intergenic
1072225949 10:93368833-93368855 CCTCATTTCTTGGAGCATGAAGG + Intronic
1072463121 10:95638501-95638523 CTTCATTTCTTGGAGGAACTAGG - Intronic
1072697013 10:97611391-97611413 GTTACTTTCCTGGGGGAAGAGGG + Intronic
1072786971 10:98290269-98290291 CTTCATTTATTGAGGGACAAAGG + Intergenic
1074303101 10:112250689-112250711 ATTGATTTATTGGGGTAAGAGGG + Intergenic
1074379911 10:112970914-112970936 CTTCATTCCTTTGTGGAAAATGG - Intronic
1075482618 10:122795758-122795780 CTTTACTTCTTTGGAGAAGAAGG - Intergenic
1075541092 10:123315066-123315088 CTACATTTCATGTTGGAAGATGG - Intergenic
1077666880 11:4119458-4119480 CTTGATTTCTTTTGGGAAAAAGG + Intronic
1077917560 11:6621457-6621479 CTTTATTTATTGGGGGTAGGGGG - Exonic
1078609034 11:12803415-12803437 GTTCATTGTTTGTGGGAAGAAGG + Intronic
1078692554 11:13596582-13596604 CTTCATTTCTTGAGAAGAGATGG - Intergenic
1078733781 11:14001111-14001133 CTCCATTTCTTGGGGGGTGGAGG - Intronic
1079887187 11:26003396-26003418 CTTCATTCCCTGGGGGAAGTGGG - Intergenic
1080260771 11:30347683-30347705 CTTCTTTTATTGTGGCAAGAAGG - Intergenic
1081107208 11:39085189-39085211 CTTTCTTTCTTTGGGGAAGTGGG - Intergenic
1081861293 11:46334564-46334586 CTCCATCACTTGGGGGAGGAAGG + Intronic
1081992591 11:47345825-47345847 CTTCATTTCTTTTCAGAAGAGGG + Intronic
1084006355 11:66325572-66325594 CTCCCTTTCTTGTGGGCAGATGG - Intergenic
1085380574 11:76113771-76113793 CTTCATTTATAAGAGGAAGAAGG + Intronic
1085751971 11:79169632-79169654 CATCATTTTTTGGGGGGAGGGGG - Intronic
1085777542 11:79380093-79380115 CTGCATGTGTTGGGGGAAGGAGG - Intronic
1087999458 11:104858708-104858730 CTTCACTTCTTGAGTGAACAGGG - Intergenic
1088003318 11:104908918-104908940 CCCCATTTCTTGGAGGCAGATGG + Intergenic
1088164352 11:106914863-106914885 CTTTTTTTCTTGTTGGAAGATGG - Intronic
1089164911 11:116468361-116468383 CCTCATTTCCTGGGGGAAGCTGG + Intergenic
1089302466 11:117506970-117506992 CTGCATTTCTAGCGGGAGGAAGG - Intronic
1091249402 11:134129625-134129647 CTTCAGTTATTGGTGAAAGAAGG + Intronic
1091297643 11:134485317-134485339 ATTGAATTCTTTGGGGAAGAAGG - Intergenic
1091686441 12:2566199-2566221 CTTCAGTTCTCCCGGGAAGAGGG - Intronic
1092122519 12:6054513-6054535 CATTGTTTCTTTGGGGAAGAAGG - Intronic
1092152808 12:6262640-6262662 CTGCATTTCTGAGAGGAAGAGGG + Intergenic
1097278546 12:57829842-57829864 TTTCATTCCATCGGGGAAGATGG + Intronic
1098712971 12:73790461-73790483 CTTCATTTTTTGAAGGAAAATGG + Intergenic
1099470034 12:83036838-83036860 CCTCATAACTTGGTGGAAGAAGG + Intronic
1099499593 12:83397038-83397060 ATTCTTTTGTTGGGGGAGGAAGG + Intergenic
1101777626 12:107808143-107808165 CTTCCTTCCTAGGGGGATGAAGG - Intergenic
1102644274 12:114393762-114393784 CTGCATTGCTTGGGAGAAGGTGG - Intronic
1103287357 12:119813668-119813690 ATGCCTTTTTTGGGGGAAGATGG - Intronic
1103643692 12:122373653-122373675 TTTCATTTCTAGGGGAAAAATGG + Intronic
1104153837 12:126111048-126111070 TATCATCTCTTAGGGGAAGAAGG - Intergenic
1104322792 12:127767678-127767700 CTTCAGTTCCTGGATGAAGATGG - Intergenic
1104725603 12:131073732-131073754 CTTCACCTCTTGGTGGAAAAGGG + Intronic
1105297356 13:19100113-19100135 TTTCTTTTCTTGGGGGAAATTGG - Intergenic
1105940340 13:25142085-25142107 CTTCATTTCATGGCTGATGAAGG - Intergenic
1106298205 13:28437700-28437722 CTTCATCTCTTAGGGAAAAAGGG - Intronic
1106650408 13:31684138-31684160 AGTCTTTTCTTGGGAGAAGATGG - Intergenic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1107545316 13:41428523-41428545 CCTCGTTTCCAGGGGGAAGAGGG + Intergenic
1107650045 13:42535844-42535866 CAGCATTTCTTGGGTAAAGATGG + Intergenic
1108208514 13:48115129-48115151 CTTCATGTGTTGGGGGCAGGGGG + Intergenic
1109355072 13:61224664-61224686 CCTCATATCCGGGGGGAAGAGGG - Intergenic
1109408033 13:61926061-61926083 TTTGCTTTCTTTGGGGAAGAAGG + Intergenic
1109743057 13:66581698-66581720 CTTCATTTCTTGGGCACACATGG - Intronic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110078635 13:71282709-71282731 CTCCAGTTCTTGGGGGTGGAGGG + Intergenic
1110945970 13:81417654-81417676 CTTCATATCTTGTAGCAAGAAGG + Intergenic
1113520977 13:110940713-110940735 CTTAATTTCCTAGGGGAAAAGGG + Intergenic
1114943684 14:27650320-27650342 CATCATTTCATGTGGGAAGATGG - Intergenic
1115848563 14:37567061-37567083 CTTTATTTCTTCGGAGAAGATGG - Intergenic
1116331813 14:43606016-43606038 ATTCATTTTTTGGTGGGAGAGGG + Intergenic
1117530720 14:56658170-56658192 CTTCATTGCTTTGTGGAAGCAGG - Intronic
1117902288 14:60547525-60547547 CTTGATTTCTTTGGGGAATAAGG + Intergenic
1119272143 14:73316414-73316436 CTTCCTTTCCTGGAGGAACAGGG + Exonic
1119917988 14:78420017-78420039 CATAGTTTTTTGGGGGAAGAAGG + Intronic
1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG + Intronic
1120662834 14:87270872-87270894 CTGCCTTTCTTTGGGGAAAATGG + Intergenic
1121098267 14:91233044-91233066 CTTCAAGGCTGGGGGGAAGAGGG + Exonic
1121866927 14:97371134-97371156 CTTCCTTTCTCAGGGGAAAAAGG - Intergenic
1121890497 14:97585675-97585697 CTTCTCTTCCTGGGGGATGAAGG + Intergenic
1121952866 14:98187333-98187355 CTTCTTTTCCTGGGGGCAGGTGG - Intergenic
1123691914 15:22845287-22845309 CTTATTTTCTTGGTGGCAGAAGG + Intronic
1125974884 15:43942519-43942541 ATGCATTTTTTGGGAGAAGAGGG - Intronic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1127498141 15:59531515-59531537 CTTCCTTTCTAGGGGGATGAGGG + Intergenic
1128386323 15:67151243-67151265 TTTCTTTTCTTTGGAGAAGAGGG + Intronic
1129015104 15:72460401-72460423 CCTCATTTTTTGGGGGGAGGGGG + Intergenic
1130577974 15:85109223-85109245 CTCCAATTCTTGGGAGAGGAGGG + Intronic
1130612649 15:85375659-85375681 TTTTATTTCTTGGGGGCAGAGGG - Intergenic
1130909676 15:88262432-88262454 TTTCATACCTTGGGGGAAGTTGG - Intergenic
1131062576 15:89413012-89413034 ATTCATGTCAGGGGGGAAGAGGG - Intergenic
1131160001 15:90099461-90099483 CTTCTCTTTTTGGGGGGAGAAGG + Intronic
1134438976 16:14286213-14286235 CTTCATCCCCTGGGAGAAGATGG + Intergenic
1135905208 16:26505785-26505807 TTTCATTCCTTGGGGGATGAGGG - Intergenic
1139018791 16:62723200-62723222 CATCATTTCATAGTGGAAGATGG + Intergenic
1139077401 16:63468969-63468991 CTTCATTGCTTGAGGGGATATGG + Intergenic
1139282573 16:65783364-65783386 TTTGATTTCTTGGGAGAAAAAGG + Intergenic
1139883666 16:70193866-70193888 CTTCTTTTTTTGGGGGATGGGGG - Intergenic
1140158622 16:72460438-72460460 TTTCAATTCTAGGGGGCAGACGG + Intergenic
1140368844 16:74401647-74401669 CTTCTTTTTTTGGGGGATGGGGG + Intergenic
1140476609 16:75242291-75242313 GTTCATTTGTCCGGGGAAGATGG - Intronic
1141443237 16:84042629-84042651 TTGCATTTCTTGGGGCCAGAGGG + Intronic
1141450279 16:84095203-84095225 TGTCACTTCTTGGGGAAAGATGG - Intronic
1141540488 16:84716630-84716652 CTTCAGAGCATGGGGGAAGAGGG + Intronic
1141840755 16:86572725-86572747 CTTCATGTCTTGGTGGCAGGAGG - Intergenic
1142923152 17:3208744-3208766 CTTCTCTTCTTGGTGGTAGAGGG + Intergenic
1144793846 17:17877902-17877924 CTTCGTGTTTTGGGGGGAGAGGG - Intronic
1145321382 17:21769345-21769367 GTCCATTCCCTGGGGGAAGAGGG + Intergenic
1145716383 17:27027125-27027147 CTTCCTTTTTTGGGGGGAGGCGG + Intergenic
1147422600 17:40330180-40330202 CTTCATTGCCTGGGGGTAGGAGG + Intronic
1148999568 17:51743154-51743176 CTTCTTTTCAAGGGGGCAGAAGG - Intronic
1149490740 17:57083669-57083691 CTTTGTTTTTTGGGGGAATAGGG - Intergenic
1149666110 17:58365699-58365721 CTTACTTTCTTGGGGGCAGGTGG - Intronic
1150181106 17:63121958-63121980 CTTCATCTCTTGCGGGGGGAGGG + Intronic
1150863340 17:68823667-68823689 TTTCATTTCTAGCTGGAAGAAGG - Intergenic
1152458177 17:80427881-80427903 CTTCCATTCATGGGGGAAGTGGG - Intronic
1153196505 18:2604147-2604169 CTTCATTTTAAGTGGGAAGATGG + Intronic
1153505790 18:5796507-5796529 CTTCATTTATTTGGCGAAGGAGG - Intergenic
1153735662 18:8064293-8064315 CTTTATTTCTTGGTTTAAGATGG - Intronic
1154139673 18:11811726-11811748 ATTCCTTTTTTGGGGGAACAAGG - Intronic
1154462104 18:14601855-14601877 TTTCATTTCTTTATGGAAGAGGG - Intergenic
1155291262 18:24344818-24344840 TTTGTTTTCTTGGGGGGAGACGG + Intronic
1156005432 18:32435360-32435382 CTACAGTTTTTAGGGGAAGAAGG + Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1157170928 18:45404439-45404461 CTTCATTACTAATGGGAAGAAGG - Intronic
1157341974 18:46787022-46787044 CCTCAATTCTTGGAGGAGGAAGG + Intergenic
1158260119 18:55597393-55597415 CTCCTTTTCTTTGGGGGAGAGGG - Intronic
1158598439 18:58836822-58836844 CCTAATTTCTTGGGGGTAAATGG + Intergenic
1158654445 18:59317539-59317561 CTTTATTTTTTGGAGGAAGGTGG + Intronic
1159803635 18:72928664-72928686 CTTCATTTTTTGGGAAAAGGAGG + Intergenic
1159887630 18:73924199-73924221 CCTCATGGCCTGGGGGAAGAGGG - Intergenic
1160617104 18:80138676-80138698 CTTCATTTTTTGGAAAAAGAAGG + Exonic
1161541491 19:4854359-4854381 CATCTTTTTGTGGGGGAAGAGGG + Intronic
1162408340 19:10489464-10489486 CTTCATTTCTGAGGGTGAGAAGG - Intronic
1162639534 19:11997231-11997253 CTTCCTTTCTTTGGGGAGGAAGG - Intergenic
1163130193 19:15267631-15267653 CTTCATGTTTTGGGGGCAGGGGG - Intronic
1164011501 19:21206667-21206689 CTACATTTCTTGGGGGTGGGGGG - Intergenic
1164596369 19:29533125-29533147 CTCCATATCTTCTGGGAAGAAGG - Intronic
1167265581 19:48481399-48481421 CCTCAGGTCCTGGGGGAAGATGG - Intronic
1168059308 19:53882442-53882464 CTGCCTTTCTTGGGGGAAACAGG - Exonic
1168247536 19:55120474-55120496 CTTGTTTTCCTGGGGGAAGGAGG - Intergenic
925642259 2:5996941-5996963 CTTCTTGTCTTGGAGAAAGAGGG + Intergenic
926755955 2:16236108-16236130 CTCCCATTCTTGGGGGTAGATGG + Intergenic
926867480 2:17375743-17375765 TTTCATTTCTAGGGAGAACAGGG - Intergenic
927031055 2:19121074-19121096 CTTCATTGTTTTGGGGAAGAAGG - Intergenic
927528243 2:23768660-23768682 CTTCATTGCTTGGGAATAGAGGG - Intronic
928008409 2:27583567-27583589 CTTCATTTCTTCTGGGCATAGGG + Intronic
932444531 2:71767977-71767999 CATCTTTTCCTGGAGGAAGACGG - Intergenic
937296601 2:120813282-120813304 CTGCATTGCTTTGGGGAAGAAGG + Intronic
938074064 2:128322635-128322657 CTTCAGTCCTTAGGGGAAGAGGG + Intergenic
938577676 2:132619544-132619566 CTTCATTTCTATGGGCAGGAAGG + Intronic
938750199 2:134320914-134320936 CATGATTTTTTGGGGGAAGGGGG + Intronic
939623169 2:144445705-144445727 CCTCATTTTTTGGGGGAAAATGG + Intronic
939689158 2:145235945-145235967 CTTTCTTTCTTGGGGCAAGAGGG + Intergenic
942122460 2:172791929-172791951 CTTTCTTTCTTTGTGGAAGATGG + Intronic
945130025 2:206561007-206561029 TTTGATTTCTTGGAGGAGGATGG + Intronic
945973422 2:216252377-216252399 CTGCATTTCTTCTTGGAAGAGGG + Intergenic
946105854 2:217368798-217368820 CTTCATTCCTTGGAGAGAGAAGG - Intronic
946894559 2:224310096-224310118 ATCCATTTCTTGAAGGAAGATGG - Intergenic
947736062 2:232456183-232456205 CTGCATGTCTTGGGGGCAGCAGG - Exonic
948420299 2:237855633-237855655 TTTTGTTTCTTGGGGGAATAGGG + Intergenic
948827757 2:240581593-240581615 CACCATTCCATGGGGGAAGATGG - Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1172557050 20:35851538-35851560 TTTCTTCTATTGGGGGAAGAGGG + Intronic
1174136021 20:48380404-48380426 TTTCATTTGTAGGGGGAAAAAGG + Intergenic
1176812457 21:13556775-13556797 TTTCATTTCTTTATGGAAGAGGG + Intergenic
1177521033 21:22226196-22226218 TTTAATTTCTTGAGTGAAGAAGG + Intergenic
1178384935 21:32141532-32141554 TTTCATCTCTCCGGGGAAGATGG + Intergenic
1178565155 21:33677233-33677255 CTGCAGTTCTTGGGAGAAGTAGG - Intronic
1179320277 21:40284893-40284915 CTTCATTTCTATGTTGAAGAAGG + Intronic
1179441659 21:41399087-41399109 CCTCATCTCATGGGTGAAGAAGG - Intronic
1180077385 21:45469549-45469571 CTTCATTTCTTGGGGTTGGGGGG + Intronic
1180799656 22:18625842-18625864 CCTCCTTTCTGGGGGGAGGAGGG + Intergenic
1180967612 22:19798758-19798780 CCTCATTTCCTGCGGGAAGCTGG - Intronic
1181222060 22:21369424-21369446 CCTCCTTTCTGGGGGGAGGAGGG - Intergenic
1182579430 22:31296245-31296267 CTCCATTTATTGGGGCAAGATGG + Intergenic
1182655670 22:31887924-31887946 CATGATTTATAGGGGGAAGAAGG + Intronic
954783107 3:53074643-53074665 CTTCATTCTTGGTGGGAAGAAGG + Intronic
955476631 3:59342914-59342936 CTTCATTAATTGGTGGCAGAGGG - Intergenic
955584645 3:60463126-60463148 CTTCATTTGTAGGTGGCAGAAGG + Intronic
956012206 3:64843932-64843954 ATGCATTTCATGGGGAAAGAAGG - Intergenic
957858440 3:85909879-85909901 ATTCATTTCTTTGGGGAAGAAGG + Intronic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
961030550 3:123599697-123599719 CTACATTTGTTGGTGAAAGAGGG + Intergenic
961347760 3:126275083-126275105 CTTCTTTTCTTGGGGTCAGGAGG + Intergenic
961559808 3:127720845-127720867 CTTTTTGTCTTGGGGGAAAATGG + Intronic
961567979 3:127777041-127777063 CTTGCTTTCTCTGGGGAAGACGG + Intronic
963733486 3:148993349-148993371 CTGCTTTTCTTTGGAGAAGAAGG - Intronic
965171388 3:165269293-165269315 CTGCATGTCTTTGGGGAGGAAGG + Intergenic
965427135 3:168540992-168541014 CATCATTTCTTGTAGGAAGATGG - Intergenic
966958155 3:184906600-184906622 CATCCTTTCTTAGGGGTAGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967327259 3:188253814-188253836 CATAATTTATTTGGGGAAGAAGG - Intronic
967689142 3:192453689-192453711 CTTGTTTTATTGGGGGATGAGGG + Intronic
969867148 4:10083505-10083527 CTTTATGTTTTGGGGGCAGAGGG + Intronic
969961794 4:10952132-10952154 ATGCATGTCTTGGGGGAAAATGG - Intergenic
970745897 4:19294903-19294925 CTTCATTTCTTTTGGGAAGGTGG - Intergenic
971188712 4:24406254-24406276 CCTAACTTCTTGTGGGAAGATGG - Intergenic
971351630 4:25861436-25861458 TTTCATTTCTTGAAGCAAGAAGG - Intronic
975341657 4:73249275-73249297 CTTTCTTTTGTGGGGGAAGATGG + Intronic
976224257 4:82782647-82782669 CTTGTTTTCTTGGGGGAGGATGG - Intronic
976799722 4:88974954-88974976 GTTCATGCCTTTGGGGAAGAAGG - Intronic
977215456 4:94278035-94278057 CTTTATTTCTTTGTGGAAAATGG - Intronic
977552323 4:98455526-98455548 CTTCTTTTCTTCTGGGTAGATGG - Intergenic
977809968 4:101347096-101347118 CTTTTATTCTTGGGGGAAGGGGG + Exonic
978279749 4:106996526-106996548 TTTGATGTCTTGGGGAAAGAAGG - Intronic
979609581 4:122674898-122674920 GTACATTTCTGGGGGGAAAAAGG + Intergenic
979611824 4:122697582-122697604 CTTCATGTCTTGGTGGCACATGG + Intergenic
979672495 4:123374730-123374752 CTTCATTTCTCTGGGATAGATGG + Intergenic
979875901 4:125890699-125890721 CATCTTCTCTTGGGTGAAGAGGG + Intergenic
979936029 4:126697388-126697410 TTTCTTTTCCTGGGGGAAGAAGG - Intergenic
982772540 4:159410781-159410803 TTTCTTTTCTTGGTGGAATAGGG + Intergenic
983615439 4:169699235-169699257 CTTAATTTCTTGATGGAAAAAGG - Intronic
983658418 4:170106997-170107019 CTCCAATTCTTTGGGGAAAATGG - Intergenic
985526411 5:405078-405100 CTGCATTTCTTTGGGGGAGGGGG - Intronic
985526616 5:406269-406291 CTGCATTTCTTGCAGGAACATGG + Intronic
985726922 5:1521417-1521439 ATTTCTTTCTTTGGGGAAGAAGG + Intronic
988158081 5:27480521-27480543 ACACATTTCTTGGGGGAAAATGG + Intergenic
988830654 5:34984024-34984046 CTTCATTTCTAGAGAGAGGAGGG - Intergenic
989452275 5:41600636-41600658 TTTCATTTCTTGGGGTCACAGGG + Intergenic
989985326 5:50690275-50690297 CTCCATTTCTTTTTGGAAGAAGG + Intronic
990363642 5:55047317-55047339 CTTCATTACTGCTGGGAAGATGG + Intergenic
991122278 5:63030505-63030527 CTTCATTGATGGAGGGAAGAAGG - Intergenic
991330373 5:65486587-65486609 CTTCATTTCTTAAACGAAGAAGG - Intergenic
991592476 5:68267640-68267662 CTTTTTTTTTTGGAGGAAGAAGG - Intronic
992395305 5:76363963-76363985 CTTCATCTTTTGGGGTCAGAGGG + Intergenic
994999736 5:107112113-107112135 CTCCATTTCATGGATGAAGAAGG - Intergenic
995070808 5:107919606-107919628 ATTCATTTGTTGGTGGAACAGGG - Intronic
995130909 5:108629557-108629579 CTTTCTTTCTTTGGGGACGAGGG + Intergenic
995535057 5:113127159-113127181 GCTCATGTCTTGTGGGAAGATGG - Intronic
996421235 5:123265206-123265228 TTGCATTTGTTGGGGGAAGAGGG - Intergenic
996654220 5:125917955-125917977 TTTAATTTCTGGGGAGAAGAGGG + Intergenic
996714703 5:126577930-126577952 GCTCATTTATTGGTGGAAGATGG + Intronic
996746612 5:126851658-126851680 CTGCATTTCTGGCAGGAAGAAGG + Intergenic
996816089 5:127573762-127573784 CTTCATGTCTTGTGGTGAGAAGG - Intergenic
997023495 5:130029845-130029867 CTCCATTTCTAGCGGAAAGATGG - Intronic
997064624 5:130546677-130546699 TTTAATTTCTGGGGAGAAGAGGG - Intergenic
997196447 5:131983462-131983484 GTTCTTTTCATGGGGAAAGATGG - Intronic
997560857 5:134845272-134845294 CTTCATTACATGGGGGAAAAGGG + Intronic
999162724 5:149517996-149518018 CTACAGTGCTTGGTGGAAGAAGG - Intronic
999685345 5:154097780-154097802 CATCATTTCTTCTGGGTAGACGG - Intronic
999850171 5:155529133-155529155 CTTCATATCATGGGAGAAAAAGG - Intergenic
1000227306 5:159277160-159277182 CTTCATTTCGTGGGGGGAGTAGG + Intronic
1002561979 5:180088721-180088743 CTTCATTTCTTGGGCGTGGCTGG + Intergenic
1006714269 6:36104804-36104826 ATTCATTTTTTAGGGGGAGAGGG + Intronic
1007041654 6:38727550-38727572 CTTCAGTCCTTGGGGGATCACGG + Intronic
1007246697 6:40468434-40468456 AATCATTCCTTTGGGGAAGAAGG + Intronic
1007636469 6:43302640-43302662 CTTCATATCTGGAGGGAAGCGGG - Exonic
1007749584 6:44063807-44063829 CATCATTTCTGTGGGGTAGAGGG - Intergenic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1009047695 6:58249301-58249323 CCTAATATCTTGGGGGCAGAGGG + Intergenic
1009223496 6:61003594-61003616 CCTAATGTCTTGGGGGCAGAGGG + Intergenic
1009539693 6:64938107-64938129 ATTTATTTCAAGGGGGAAGAAGG + Intronic
1009714398 6:67369898-67369920 CTTGTTTCCTTGGGGAAAGATGG - Intergenic
1011183197 6:84644769-84644791 CTTTATTTCTTGGGAGAATCTGG - Intergenic
1011603506 6:89081066-89081088 CCTCATTTCCTAGGGGGAGATGG + Exonic
1011948867 6:92939299-92939321 GTTCACTTGTTGGGGGAAGGGGG - Intergenic
1012191454 6:96285376-96285398 CTTCAGCTCTTTGGGAAAGACGG + Intergenic
1013324668 6:109032609-109032631 CTTCATCTCGTGGGGGGAGTGGG + Intronic
1013326812 6:109054074-109054096 CTTAATTTTTTGGGGGGGGAGGG + Intronic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1017311070 6:152978367-152978389 CTTCATTTTTTGGGGGGGGGGGG + Intronic
1017688995 6:156944655-156944677 TTTCATTTCTTGGTGGGGGAAGG + Intronic
1018500666 6:164407821-164407843 CTGCATTCCTTTGGAGAAGAAGG - Intergenic
1020035470 7:4960545-4960567 CATGAAGTCTTGGGGGAAGAGGG - Intergenic
1021421895 7:20454989-20455011 CTTCATTTCTTGACGTAAGAAGG + Intergenic
1021522604 7:21552567-21552589 TTTAATTTCTGGGGAGAAGAGGG - Intronic
1022134499 7:27434734-27434756 CCTCATTTGTTTGGGGGAGATGG - Intergenic
1022422704 7:30238983-30239005 CTACATTTCTTGGGCAAATAAGG - Intergenic
1026400624 7:70009133-70009155 CTTCATTCCATGGGAGAAGGTGG + Intronic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1026830364 7:73606792-73606814 CTTCTCTTCTTGGGGGGTGAGGG - Intronic
1030387764 7:108886579-108886601 CTTCATTTCTTAGGAGATGAAGG - Intergenic
1031313681 7:120231099-120231121 CTTCTTTTATTGGGGGAAAGTGG - Intergenic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032532506 7:132633868-132633890 CTTCATTCCTTGGGTGACAAGGG - Intronic
1032997313 7:137462417-137462439 CTTATTTTCTTGTGTGAAGACGG - Intronic
1034254398 7:149716363-149716385 CTCCATTGGTTGGGGGAAGGAGG + Intronic
1034830831 7:154305929-154305951 CTTTGTAACTTGGGGGAAGAGGG + Intronic
1035109501 7:156469349-156469371 CTTCACTTTGTGGGGGCAGAGGG + Intergenic
1035520153 8:269359-269381 CTTTTTTTCTTGGGGGAGGGTGG - Intergenic
1035838686 8:2787112-2787134 CTTCATGGCTTGGGGGAAAGTGG + Intergenic
1037784747 8:21895961-21895983 CCTCATCTCCTGGGGGCAGAAGG + Intergenic
1038044698 8:23756185-23756207 ATTCATTTCTTTGGGGTATAGGG + Intergenic
1038285723 8:26204713-26204735 TTTCATTTCTTTTGGGAAGAGGG - Intergenic
1039683138 8:39764402-39764424 CTTCTTTTTTGAGGGGAAGAGGG - Intronic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1040365492 8:46710934-46710956 CTCCATGTTTTGGGGGCAGAAGG + Intergenic
1042413921 8:68497821-68497843 CTTCTATTTTTGGGGGGAGATGG + Intronic
1042881549 8:73498151-73498173 CCTTATTTCTGGGGGGAAAAAGG + Intronic
1043633409 8:82364794-82364816 CATAATATCTAGGGGGAAGAGGG + Intergenic
1044975019 8:97656038-97656060 TTCCATTTTTTGGGGGAAGTTGG + Intronic
1045583210 8:103500726-103500748 CTGCTTTTCTTGGGGGAGGGGGG + Intronic
1046320563 8:112568665-112568687 ATTTATTTGTTGGTGGAAGAAGG + Intronic
1047943821 8:129853840-129853862 ATTAATTTCTTGGAGGAAAACGG + Intronic
1048012719 8:130471194-130471216 CTTCCCTTTTTGTGGGAAGAGGG - Intergenic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1048933631 8:139337181-139337203 CTTCATTGCTTGGGGAAAGGAGG + Intergenic
1049034043 8:140060704-140060726 GTTTATTTCTGGGGGGAGGAAGG + Intronic
1049178789 8:141209842-141209864 CTTGATTTTTAGGAGGAAGAGGG - Intronic
1050149887 9:2608959-2608981 CATCATTTTTGGGGGGAAAAGGG + Intergenic
1051177338 9:14374258-14374280 CTTCTTTTCTTTGGGAAGGAGGG - Intronic
1051774717 9:20621604-20621626 TTTCATTTTTTGGGGGGAGGTGG - Intronic
1051907705 9:22115611-22115633 TTTCCTCTCTTGGGTGAAGATGG + Intergenic
1056199270 9:84258651-84258673 CATCATTGCTTGGGGTAAGACGG + Intergenic
1056746649 9:89309687-89309709 AATCACTTCTTGGGGGAAGAGGG - Intergenic
1056769404 9:89465981-89466003 CTGCATTTCTTGGAGGCAGGGGG + Intronic
1056904350 9:90632381-90632403 TTTGATTACCTGGGGGAAGAGGG - Intronic
1057978690 9:99635485-99635507 CTTCATTTCTTTTGAGAAGCAGG - Intergenic
1058587091 9:106520467-106520489 CTTAATTTTGTGGGTGAAGAGGG + Intergenic
1058981186 9:110172316-110172338 TTTCTTTTTTTGGGGGAGGAGGG + Exonic
1059431258 9:114251761-114251783 CTTCAGCTCTTGGGTCAAGAGGG + Intronic
1060736473 9:126069601-126069623 CTTCATTTCCTGGGGGAAGGGGG + Intergenic
1061237235 9:129350288-129350310 CTTCATGTCTTATGGGAAGGGGG - Intergenic
1061533219 9:131230818-131230840 ACTCATTTCTTTGGGGGAGAAGG - Intronic
1185828080 X:3272147-3272169 CTTCCTCTCTTTGAGGAAGATGG - Intronic
1186864839 X:13709478-13709500 CTTCATTAGTTGGTGGGAGAAGG + Exonic
1187259631 X:17673345-17673367 CTTCCTTTCTGGGGTGAACATGG + Intronic
1187790416 X:22944233-22944255 CTTGGTTTCTTCGTGGAAGAAGG - Intergenic
1188334764 X:28917147-28917169 CTTCATTGCCTGAGGGAAGATGG + Intronic
1189226142 X:39414852-39414874 TTTTATTTCTTGGGGAAAAAAGG + Intergenic
1189905686 X:45756920-45756942 CAGCATTTCTTGGGGGGAGGGGG - Intergenic
1193378366 X:80788627-80788649 CTTCATTTCTTTGGGTAAATAGG - Intronic
1194025828 X:88749242-88749264 ATGCTTTTCTTGGGGGAAGAAGG + Intronic
1194556424 X:95366494-95366516 CTTGATTTTTTGTGGGAAGTTGG + Intergenic
1195302390 X:103543400-103543422 GTTCATTACTTGGGGCTAGATGG + Intergenic
1196579874 X:117366412-117366434 TCTCTTCTCTTGGGGGAAGAAGG - Intergenic
1197702717 X:129611443-129611465 ATAGAATTCTTGGGGGAAGAGGG + Intergenic
1197887058 X:131229546-131229568 ATACATTTCTTGGGGGCAAAGGG + Intergenic
1198501893 X:137257996-137258018 CCTTATTTCATAGGGGAAGAAGG + Intergenic
1200184303 X:154171879-154171901 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200189955 X:154209012-154209034 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200195708 X:154246821-154246843 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200201362 X:154283937-154283959 CTGCATTGCTGGTGGGAAGATGG + Intronic