ID: 1120110131

View in Genome Browser
Species Human (GRCh38)
Location 14:80544419-80544441
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120110131_1120110137 4 Left 1120110131 14:80544419-80544441 CCTAGCTTATGTAGACAGCCCCC 0: 1
1: 0
2: 2
3: 3
4: 81
Right 1120110137 14:80544446-80544468 TGAGGTGTCCTCACATAGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120110131 Original CRISPR GGGGGCTGTCTACATAAGCT AGG (reversed) Intronic