ID: 1120110131 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:80544419-80544441 |
Sequence | GGGGGCTGTCTACATAAGCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 87 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 3, 4: 81} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1120110131_1120110137 | 4 | Left | 1120110131 | 14:80544419-80544441 | CCTAGCTTATGTAGACAGCCCCC | 0: 1 1: 0 2: 2 3: 3 4: 81 |
||
Right | 1120110137 | 14:80544446-80544468 | TGAGGTGTCCTCACATAGCCAGG | 0: 1 1: 0 2: 0 3: 6 4: 162 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1120110131 | Original CRISPR | GGGGGCTGTCTACATAAGCT AGG (reversed) | Intronic | ||