ID: 1120115279

View in Genome Browser
Species Human (GRCh38)
Location 14:80609459-80609481
Sequence GGATGGGGGTGGGGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1512
Summary {0: 1, 1: 2, 2: 17, 3: 175, 4: 1317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120115279_1120115295 16 Left 1120115279 14:80609459-80609481 CCCTCTGGCCCCCACCCCCATCC 0: 1
1: 2
2: 17
3: 175
4: 1317
Right 1120115295 14:80609498-80609520 TCCATTTTCCCACATGGTGATGG 0: 1
1: 0
2: 1
3: 11
4: 183
1120115279_1120115287 -10 Left 1120115279 14:80609459-80609481 CCCTCTGGCCCCCACCCCCATCC 0: 1
1: 2
2: 17
3: 175
4: 1317
Right 1120115287 14:80609472-80609494 ACCCCCATCCACTGGGTATTTGG 0: 1
1: 0
2: 1
3: 11
4: 113
1120115279_1120115289 -9 Left 1120115279 14:80609459-80609481 CCCTCTGGCCCCCACCCCCATCC 0: 1
1: 2
2: 17
3: 175
4: 1317
Right 1120115289 14:80609473-80609495 CCCCCATCCACTGGGTATTTGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1120115279_1120115294 10 Left 1120115279 14:80609459-80609481 CCCTCTGGCCCCCACCCCCATCC 0: 1
1: 2
2: 17
3: 175
4: 1317
Right 1120115294 14:80609492-80609514 TGGGTGTCCATTTTCCCACATGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120115279 Original CRISPR GGATGGGGGTGGGGGCCAGA GGG (reversed) Intronic
900087627 1:905995-906017 GGGCAGGGCTGGGGGCCAGAGGG - Intergenic
900122762 1:1055953-1055975 GGATGGGGGTGGGGAAGGGACGG - Exonic
900124273 1:1062594-1062616 GGATGGGGGTCGGGGGGAGGAGG - Intergenic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900313070 1:2043719-2043741 TGAGCGGGGTGGGGGCCTGAAGG + Intergenic
900336523 1:2166728-2166750 GGGTGGGGGTGGGGGGCTGAAGG - Intronic
900913541 1:5618876-5618898 TGATGGGGAGGGGGTCCAGATGG + Intergenic
900946150 1:5832415-5832437 AGAAGGGGGTTGGGGGCAGAGGG - Intergenic
901002543 1:6155756-6155778 GGATGGGGGTGCAGGTCAGAAGG - Intronic
901131221 1:6963264-6963286 GGGGGGGGGGGGGGGCCAGGTGG - Intronic
901167265 1:7229543-7229565 GGATGGGGATGGGGTGGAGAGGG + Intronic
901217886 1:7565021-7565043 GGATGGGGGGTGGGAGCAGAAGG + Intronic
901311163 1:8270625-8270647 CGCTGGGGGTGGGGTCGAGAAGG + Intergenic
901642331 1:10699020-10699042 GGTTGGGGGTGGGAGCAAGATGG + Intronic
901742126 1:11348949-11348971 GGATGGGGTTGGGGTAGAGAGGG - Intergenic
901757851 1:11452199-11452221 GGTTGGGGGAGGGGGGCAGCTGG - Intergenic
901843259 1:11966520-11966542 GGATGGGGGTGGGGGGAGGCAGG + Intronic
901848795 1:12001940-12001962 GGAGGGAGGTGGGGGCCACCAGG - Intronic
901929809 1:12589947-12589969 AGATGGAGGTGGAGACCAGATGG - Intronic
901944593 1:12691372-12691394 GGGTGGGGGTGGGGGCAATGGGG + Intergenic
902319884 1:15654272-15654294 GAATGGGTGTGGGTGGCAGATGG + Intronic
902419573 1:16268117-16268139 TAATGGGGGTGGGGGGCATAGGG + Intronic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902798651 1:18815870-18815892 GGCTGGGGGTGGGGGACTGGCGG - Intergenic
902826576 1:18978778-18978800 GGATGGGGGTAGGAGGCTGAAGG - Intergenic
903017098 1:20368355-20368377 GGACGGGGGTGGAGGGCAAATGG - Intergenic
903062733 1:20681536-20681558 GGACGGTGGTGGGGGCGAGGGGG + Intronic
903126264 1:21250130-21250152 GAGTGGGGGTTGGGGCCAGTGGG - Intronic
903221854 1:21873679-21873701 GGCTGGGGCAGGGGGCCAGGGGG + Intronic
903231134 1:21922952-21922974 GGGTCGGGGTGGGGGCGGGATGG - Intronic
903277896 1:22233249-22233271 GGCTGGGTGTGGGGGCAAAACGG + Intergenic
903282846 1:22259768-22259790 GGATGGGGGTGGTGACAAGGAGG + Intergenic
903435076 1:23343755-23343777 GGATGGGGGTGGGGGGCGGAAGG - Intronic
903906364 1:26690223-26690245 GGTTGGGGGTAGGGACCAGCAGG - Intergenic
904005837 1:27362757-27362779 GGGTGGGGGTAGGGGGCACAGGG + Intronic
904043447 1:27597139-27597161 GTATGGGGGTGGGGGGCAGGTGG + Intronic
904047242 1:27616028-27616050 GGAAGGGGGTGGCACCCAGAGGG + Intronic
904287501 1:29461736-29461758 GGATGGAGGTGAGGGGCACAGGG - Intergenic
904491127 1:30859792-30859814 GGATGGTGGTGAGGGCAGGAGGG - Intergenic
904756548 1:32771479-32771501 GGGTGGGGGAGGGGGCCAGTTGG - Exonic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904859335 1:33523017-33523039 GGATGGAGGTTGGGGGCAGAGGG - Intronic
905172731 1:36118674-36118696 GGTTGGGGGTGGGGGGCGGGGGG - Intronic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905324809 1:37144040-37144062 GGTTGGGGGAGGGGGGCAGGGGG - Intergenic
905369728 1:37476637-37476659 GGATGGGGGTGGGAGTCACTGGG - Intronic
905406411 1:37735440-37735462 GGCTGGGGGTGCGGGGAAGAGGG + Intronic
905536739 1:38728410-38728432 GGGTGGGAGTGGGGGCTGGAGGG - Intergenic
905580910 1:39082045-39082067 GGAAACGGGTGGGGGCCAGGTGG + Intronic
905770842 1:40636949-40636971 GGATGGGGGAGATGGCCTGAGGG + Intronic
906040625 1:42785501-42785523 AGACGGGGGTGGGGGCGAGGAGG - Intronic
906110312 1:43318085-43318107 GGGGGCGGGTGGAGGCCAGAGGG + Intronic
906147588 1:43569212-43569234 GGGTGGGGGGGGGGGCTAGCAGG - Intronic
906148456 1:43573707-43573729 AGATGGGTGTGGGGGACTGAAGG - Intronic
906235531 1:44205806-44205828 TGATGGGGGGTGGGGGCAGAGGG + Intergenic
906279346 1:44542878-44542900 GAGTGGGGCTGGGGGCCGGAGGG + Intronic
906812577 1:48844057-48844079 GGCTGGTGTTGGGGGGCAGAAGG - Intronic
906962084 1:50425061-50425083 GAATGGGGGTGGGGGAAGGACGG + Intergenic
907108937 1:51909002-51909024 GGCTGGGGCTGGGGCCCAGGAGG - Exonic
907251426 1:53142257-53142279 GGAGGGGCGTGTGGGCCTGAGGG - Intronic
907332151 1:53678331-53678353 GGGGGGGGGTGGGGGGCAGGGGG + Intronic
907477312 1:54714401-54714423 GCAAGTGGGTAGGGGCCAGAAGG - Intronic
907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG + Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
909078385 1:71080653-71080675 GGAGGGGGGTGGGGGCAAAAAGG + Intronic
909252392 1:73375464-73375486 GGGTGGGGGTGGGGGCTAAGTGG - Intergenic
910269421 1:85377705-85377727 GTATGGGGGTGGGGGGATGAGGG - Intronic
910348521 1:86268962-86268984 GGATGGTGGTAGAGGCCAGCAGG - Intergenic
910429531 1:87147339-87147361 GGTTGGGGGTGGGGGGGAGGTGG + Intronic
910631282 1:89357485-89357507 GGATGAGGGTGTGGGCCTAAGGG + Intergenic
910884090 1:91947918-91947940 GGCTGGGGGTGGGGGTGGGAAGG - Intergenic
911433842 1:97829893-97829915 GTCTGGGGGTGGGGGGCTGAGGG - Intronic
911645015 1:100328586-100328608 GCAAGGTGGTGGGGGACAGATGG + Intergenic
911759204 1:101597403-101597425 GGACAGGGGTGGGGGTCACAAGG + Intergenic
912382729 1:109255937-109255959 CGATGGCGGTGGGGGACACAGGG + Intronic
912633796 1:111271802-111271824 GGGTGGGGGTGGGGGACAATGGG - Intergenic
912798096 1:112704998-112705020 TGCTGGGGGTGGGGGACACATGG - Intronic
912945131 1:114078377-114078399 GGAGGGGACTGGTGGCCAGAAGG + Intergenic
913053925 1:115140211-115140233 GGATGGGGGTGGGGGCCTCGTGG + Intergenic
913442168 1:118909505-118909527 GGATGGGGCTGGAAGCCAGGAGG + Intronic
914424282 1:147560490-147560512 GGATGGGGGTAGGGCGCCGAGGG + Intronic
914514502 1:148362612-148362634 GGGTGGGGGTGGGGGGCGGTGGG - Intergenic
915034679 1:152911694-152911716 GGGTGAGGGTGGGGGAGAGAGGG + Exonic
915245573 1:154553849-154553871 TGTTGGGGGTGTGGCCCAGAGGG + Intronic
915289336 1:154872494-154872516 GGTTGGGGGTGGGTTCTAGAGGG - Intergenic
915316082 1:155029958-155029980 GGCTTGGGGCAGGGGCCAGAGGG - Intronic
915349081 1:155213384-155213406 GGATGGAGGTAAGGGGCAGATGG + Exonic
915352268 1:155234011-155234033 GGATGGAGGTAAGGGGCAGATGG + Intergenic
915437295 1:155917599-155917621 GGCTGGGGCTGGGGGCCAGCAGG + Exonic
915468416 1:156111838-156111860 TGATGGGAGTGGTGGCTAGAGGG - Intronic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915597755 1:156905078-156905100 GGGTTGGGGGGGGGGCAAGAAGG + Intronic
915621299 1:157086556-157086578 GGATGGGGGTGGGGAGGAGTAGG - Intergenic
915910758 1:159913860-159913882 GGCTAGGGCTGGGGGCCAGGGGG - Intergenic
915914171 1:159931282-159931304 GGATGGTGGTCAGGGCCTGAGGG + Intronic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916427011 1:164690219-164690241 GGATGGGGGTGGGAGAGGGAGGG + Intronic
916942281 1:169688516-169688538 GGGTAGGGGTGGGGGTCACAAGG - Intronic
917019941 1:170575204-170575226 TGTTGGGGGTGGGGGGCAAAGGG + Intergenic
917288653 1:173448602-173448624 GGATGGGAGTGGGGGTCACAAGG + Intergenic
917441948 1:175076156-175076178 AGATGGGGGTTGGGGGCACAAGG + Intronic
917854569 1:179090108-179090130 GGGTGGGGGGGGGGGCCTGCGGG + Intronic
918054056 1:181003269-181003291 GGATAGGGATGGGGGACAGATGG - Intronic
918073073 1:181147973-181147995 GGAATGGGGTGGGGGTGAGATGG + Intergenic
918077075 1:181178503-181178525 GGATGGGGTGGGGGGGCAGCGGG + Intergenic
918782708 1:188723244-188723266 GGATGGGGGTTGAGGGCAGTGGG - Intergenic
919780170 1:201216345-201216367 GGATGGGGGTGGGGGGGAGTCGG + Intronic
919805922 1:201380983-201381005 GCATGGGGGTGGGGGTTGGAGGG + Exonic
919841699 1:201614046-201614068 AGATGGGGCTGGGGGCGAGTGGG + Intergenic
920074382 1:203325855-203325877 GGATGGGGGTGGGGGAGGTAGGG + Intergenic
920194303 1:204216804-204216826 GGCTGGGGGTGGGGGCAGGAAGG - Intergenic
920203455 1:204274971-204274993 GGATGAGGGTGGGGGCGGGGTGG + Intronic
920249973 1:204617085-204617107 TGATGGGCATGGGGGCCAGCTGG - Intergenic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920366346 1:205450106-205450128 GGGTGGGGGTGGGGGCGGGCTGG + Intronic
920506311 1:206517872-206517894 GGGTGGGGGAGGGGCCCATAAGG - Intronic
920534436 1:206728579-206728601 GGCTGGTGGGGGGGGCCAGCAGG + Intronic
920607063 1:207399062-207399084 GGTTGGGGGTGGGGGCTGGGAGG + Intergenic
920735193 1:208527167-208527189 GGCCGGGGGAGGGGGGCAGAAGG - Intergenic
920915813 1:210257375-210257397 GGATGTGGTTGTGAGCCAGATGG - Intergenic
920983175 1:210857450-210857472 GCATGGGGGTGGGGGTGAGGGGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921289035 1:213637412-213637434 GGGTGGGGGTGGGAGGCAGGGGG + Intergenic
921326615 1:213990433-213990455 GGTGGGGGGTGGGGGCAAGTTGG + Intronic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921939841 1:220828116-220828138 GTATGGGGGTGGGGGGCAGCTGG - Intergenic
922121286 1:222671629-222671651 GGATGTGGGTGAGGGAGAGATGG + Intronic
922324216 1:224513344-224513366 GGGTGGGGGTGGGGGTGGGAGGG + Intronic
922575089 1:226655887-226655909 GGATGGGAGTGGGGGTCACCAGG - Intronic
922730446 1:227946554-227946576 GGCTGCGGGTGGGGGCCCCAGGG + Intronic
922820791 1:228484087-228484109 GGCGGGGGGTGGGGGAGAGAAGG - Intergenic
922881363 1:228983515-228983537 GGTTGGAGGTGGGCCCCAGAAGG - Intergenic
923015038 1:230120161-230120183 GGGTGGGGGTGGGGGTGAGTGGG + Intronic
923434705 1:233956925-233956947 GGATAGGGGTAGAGGCCAAATGG + Intronic
923473440 1:234312296-234312318 GGACGGGGGAAGGAGCCAGAAGG + Intronic
923630695 1:235648182-235648204 GCATGGAGGTGGGGGCCAACAGG + Intronic
923661018 1:235957243-235957265 GGCTGGGAGGAGGGGCCAGAGGG + Intergenic
924036922 1:239947126-239947148 GGATGGGGTGGTGGGCTAGAAGG - Intergenic
924643983 1:245860155-245860177 GGAGGGGTGTGGGGGCACGAAGG - Intronic
924947781 1:248857792-248857814 GGCAGGGGGTGAGAGCCAGAGGG - Intronic
1062908471 10:1195812-1195834 AGATGATGGTGGGGGCCAGTTGG + Intronic
1063671773 10:8104948-8104970 CGATGGGGGTGAGGGTGAGAGGG - Intergenic
1063707827 10:8448069-8448091 GCCTGGGGCTGGGGGCTAGAGGG + Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064177711 10:13089813-13089835 GGAGGGGGGTGGGGGATAAAAGG - Intronic
1064384326 10:14877909-14877931 GGAGGGGGGTGGAGACCAGGTGG + Intergenic
1064978442 10:21142864-21142886 TGTTGGGGGTGGGGGGCAGGAGG - Intronic
1065099842 10:22321722-22321744 GGACGGGGCTGGGGGCCGGCGGG + Intronic
1065186265 10:23173615-23173637 GGACGGGGGTGGGGGCGTGTGGG - Intergenic
1065773244 10:29096868-29096890 GGATGGGGATGGGGATCAGATGG - Intergenic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1066447951 10:35500929-35500951 GGTTGGGGTTGGGTGCCACAAGG + Intronic
1066665921 10:37782453-37782475 GGTGGGGGTTGGGGGGCAGAGGG + Intronic
1067154079 10:43760410-43760432 GGTTGTGGGTGGGGGACAAAGGG + Intergenic
1067282617 10:44883800-44883822 GGATGGAGCTGGTTGCCAGAGGG - Intergenic
1067561139 10:47305506-47305528 GGAAGGGGCGGTGGGCCAGACGG - Intronic
1067651247 10:48156678-48156700 GGATGGGGGGGCTTGCCAGAGGG + Exonic
1067741173 10:48897081-48897103 GGGTGAGAGTGGGGGCCAGCAGG - Intronic
1067830753 10:49610031-49610053 GGCAGGGGGCGGGGGGCAGAGGG + Intronic
1068474204 10:57505220-57505242 GGCTGGGGGTGGGGGAATGAGGG - Intergenic
1069308368 10:67001442-67001464 AGACAGGGGTGGGGGACAGAAGG + Intronic
1069314197 10:67077426-67077448 GGATGGGGGAGTGGGGCAAAGGG - Intronic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069633629 10:69912540-69912562 GGGTGGGGGTGGGGGGCGGTCGG - Intronic
1069693373 10:70369272-70369294 GGATGGGGGTGGGGATGAGGAGG - Intronic
1069903152 10:71717352-71717374 CGAAAGGGCTGGGGGCCAGAGGG - Intronic
1069909598 10:71751324-71751346 GGTTGAGGGTGAGGGGCAGAGGG - Intronic
1069909622 10:71751392-71751414 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1069909645 10:71751460-71751482 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1069909668 10:71751528-71751550 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1070157032 10:73841484-73841506 GGGTGAGGGTGGGGGCAAGAGGG + Intronic
1070367415 10:75750481-75750503 GGCGGGGGGTGGGGGGCAGAGGG + Intronic
1070623800 10:78034173-78034195 GGATGGGGGTAGGGGGCGGGCGG + Intronic
1070801248 10:79245518-79245540 GGACGGGGTCGGGGGGCAGAGGG + Intronic
1070850649 10:79559450-79559472 AGATGAGGGTGAGGGCCAGAGGG + Exonic
1070856570 10:79611837-79611859 AGATGAGGTTGAGGGCCAGAGGG - Exonic
1070970741 10:80565296-80565318 GGCTGGGGGTGGGGGGTACAGGG - Intronic
1071064449 10:81614273-81614295 GCATGGGGATGGGGGTCGGAGGG + Intergenic
1071187777 10:83063156-83063178 GGACAGGGGTGGGGGTCACAAGG - Intergenic
1071798977 10:89036882-89036904 GGGTGGGGGTGGGGGTGGGAGGG - Intergenic
1071879090 10:89875143-89875165 GAATGGTGGTGGGGGCAGGAAGG - Intergenic
1072100013 10:92220476-92220498 GGATGGGGGTGGGGTGGGGAAGG - Intronic
1072247422 10:93555625-93555647 GGATAGGGGTGGGGGTGGGAGGG - Intergenic
1072280389 10:93860651-93860673 TGATGGAGGTGGGGCCTAGAGGG + Intergenic
1072550561 10:96474203-96474225 GGATGTGTGTGGGGGCAAGGCGG - Intronic
1072616137 10:97049859-97049881 GGATGGTGGCGGGGAGCAGATGG + Intronic
1072719061 10:97769762-97769784 GGGTGGGGTTGGGGGACAGTTGG + Intronic
1072729696 10:97837407-97837429 GGTGGTGTGTGGGGGCCAGATGG + Intergenic
1073043310 10:100621784-100621806 GGAAGGGGGTGGGGGGCTGCGGG + Intergenic
1073137968 10:101230045-101230067 GGTTGGGGGAGGGGGCTAGTCGG + Intergenic
1073139705 10:101239007-101239029 GGATGGGCGTGGGGGCTTCAAGG - Intergenic
1073141926 10:101253961-101253983 GGATGGGGGTAGGGGCAGGAAGG - Intergenic
1073178173 10:101569141-101569163 GGAGGGGGGTGGGGGGCACCAGG + Intergenic
1073214278 10:101828092-101828114 TGATGGGGGTGGCGTGCAGAGGG - Intronic
1073331747 10:102674482-102674504 GGAGAGGGCTGGGGGCCGGAGGG - Exonic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073778096 10:106808378-106808400 GCATGGGAGTGAGGGCCAGGAGG - Intronic
1074011784 10:109489715-109489737 TGCTGGAGGTGGGGGCCTGATGG - Intergenic
1074132167 10:110589501-110589523 GGATGGGGGAGGCGGACAAAAGG - Intronic
1074324010 10:112430094-112430116 GGATGGCAGTGGTGGCCTGAGGG - Intergenic
1074945395 10:118276279-118276301 GGATAGAGGTTGGGGCCAGATGG - Intergenic
1075030861 10:119023816-119023838 GGTTGGGGGTGGGGGGCACATGG + Intergenic
1076182259 10:128419337-128419359 GGATGAGGGTGGGAGCTACAGGG + Intergenic
1076372936 10:129966818-129966840 GGATGGGGTGGGGGACCAGGGGG - Intergenic
1076584639 10:131537252-131537274 GGCTGGGGGTGGGGGCTGGGTGG - Intergenic
1076605770 10:131689102-131689124 GAATGAGGGTGAGGGCCAGTGGG - Intergenic
1076647417 10:131962759-131962781 GGTTGGGGGTGGAGCCCAGCAGG - Intergenic
1076668553 10:132106435-132106457 GGAACGGGGGCGGGGCCAGATGG - Intronic
1076683522 10:132186887-132186909 GGGTGGGGGCGGGGCCCAGCGGG + Exonic
1077032395 11:474391-474413 GGGTGGGTGAGGGCGCCAGATGG + Intronic
1077095107 11:795860-795882 GGATGGGGGTGCCAGCCACAGGG - Intronic
1077168288 11:1153448-1153470 GGATGGGGGTTGGGAGCTGAGGG + Intergenic
1077308866 11:1879744-1879766 GGCTGGGAGAGGGGGACAGAGGG + Intronic
1077325201 11:1960771-1960793 GGAGGTGGGTGGGGGCAGGATGG - Intronic
1077516111 11:3003033-3003055 GGATGGGGATGGTGGGCGGAGGG + Intronic
1077870752 11:6259785-6259807 GGCTGGGGGCGGGGACCAGGCGG + Exonic
1077891090 11:6418862-6418884 GGATGGGGGATGGGGCCGGCCGG + Intronic
1078054079 11:7992944-7992966 GGATGGGGTTGGGGGCCTCTCGG - Exonic
1078150806 11:8758266-8758288 GGATGGGGGTAGGAGGAAGAGGG - Intronic
1078379269 11:10825356-10825378 AGATGGGGGTGAGGAACAGATGG + Intronic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1078533589 11:12156034-12156056 GGAAGAGGGTTGGGGCCAGAAGG + Intronic
1078535939 11:12174344-12174366 GGGTGGGGGTGGGGAGGAGAGGG - Intronic
1078605617 11:12772434-12772456 GGATGGGGGGAGGGCCGAGAGGG + Intronic
1078672109 11:13374883-13374905 GGAGGTGGGCTGGGGCCAGAAGG - Intronic
1079174791 11:18128911-18128933 GGAGGGGGGTGGAGCCAAGATGG - Intronic
1079242271 11:18729350-18729372 GGCGGGGGGTGAGGGGCAGATGG - Intronic
1079344214 11:19637789-19637811 TGTTGGGGGTGGGGCCCAGTGGG - Intronic
1079456086 11:20637325-20637347 GGCTTGGGGTGGGGGCAGGAGGG + Intronic
1079688900 11:23398124-23398146 GGATGAGGGTGGGGGGCTGAGGG - Intergenic
1079884687 11:25972482-25972504 GGATGGGGGTGGGGGAAGCAGGG + Intergenic
1079987776 11:27216422-27216444 GGAAGGGGGTGGGCGTCAGGGGG + Intergenic
1080055769 11:27904718-27904740 GGCTCAGGGTGGGGGCCAGAGGG + Intergenic
1080083738 11:28253590-28253612 GGCTGGGGGTTGGGGCCATGAGG - Intronic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080399258 11:31919069-31919091 AGATGAGGGAGGGGGCTAGAAGG + Intronic
1080623769 11:34009812-34009834 GGAAGGGAGTAGGGGCCATAAGG + Intergenic
1080864441 11:36180758-36180780 GGTTGGGGGTGGGGTGCGGATGG + Intronic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081586326 11:44386523-44386545 GGATGGAGATGGAGCCCAGAGGG - Intergenic
1081992054 11:47343219-47343241 GGCTTGGGGTGGGGGGCACAGGG - Intronic
1082197183 11:49320770-49320792 GGACAGGGGTGGGGGTCACAAGG + Intergenic
1082799800 11:57406257-57406279 GGATGGGGGTGGAAGGCAGGGGG - Intronic
1083045294 11:59729123-59729145 GGATGGTGATGGTGGCCACACGG - Intronic
1083074307 11:60020480-60020502 GGGTGGGGGCGGGGGCCAGCCGG + Intergenic
1083265797 11:61546297-61546319 GGGTGGCGGTGGGGGAGAGAGGG + Intronic
1083306375 11:61764122-61764144 AGCTGGGGGTGGGGGTCAGCAGG + Intronic
1083628725 11:64085150-64085172 GGATGGGGCTTGAGGGCAGAGGG + Intronic
1083695739 11:64440997-64441019 GGCTGGGGGTGGAGGCCTGGGGG + Intergenic
1083725382 11:64625321-64625343 GGATGGGGCCAGGGGCCACAGGG - Intronic
1083815585 11:65130683-65130705 GGTGGGGGGTGGGGGGCAGGGGG + Exonic
1083949378 11:65945657-65945679 GGATGGGGGATGGGGCAGGATGG + Exonic
1083962269 11:66021054-66021076 GGGCTGGGGTGGGGGCCTGAGGG - Intronic
1084006599 11:66326605-66326627 GGATGGGGCTGGGGGCAGGGCGG - Intergenic
1084066597 11:66707937-66707959 GGATGGGGGTGGGATAGAGAGGG - Intronic
1084068728 11:66720314-66720336 GGATGGAGGAGGAAGCCAGACGG + Intronic
1084148057 11:67275461-67275483 GGAAGGGGGTGGGTGGGAGAAGG - Intronic
1084150546 11:67286096-67286118 TGCTGGGGGTTGGGGCAAGAGGG - Exonic
1084239048 11:67806079-67806101 GGCTTGGGGTGGGGCCGAGACGG + Intergenic
1084411093 11:69006294-69006316 GTCTGTGGGTGGGGGCCAGCCGG - Intronic
1084436616 11:69145829-69145851 TGTTGGGGGTTGTGGCCAGAGGG - Intergenic
1084647154 11:70465143-70465165 GGAGGGTGGGTGGGGCCAGATGG + Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1084870816 11:72097592-72097614 GGGATGGGGTGGGGGCCAAAAGG - Exonic
1084952589 11:72674839-72674861 GGATGGGGCTGGGGACTTGAGGG + Intergenic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085348628 11:75784059-75784081 TGTTGGGGGTGGGGGCAAGAGGG + Intronic
1085385931 11:76158429-76158451 GCCTGGGGGTGGGGGCGAGAGGG - Intergenic
1085398990 11:76224358-76224380 GGTTGGGGGTGGGGGACAGCGGG + Intergenic
1085485702 11:76861095-76861117 GGAGGGGAGTGGGGGCGAGAGGG + Intronic
1085505603 11:77056895-77056917 GGGTGGGGGTGGGGGGCATATGG - Intergenic
1085784602 11:79439117-79439139 GGTGGGGGGTGGGGGGAAGAGGG - Intronic
1086165303 11:83771045-83771067 GGAGGGGTGTGGGAGACAGAAGG - Intronic
1087014562 11:93543059-93543081 GGGCGGGGTTGGGGGCCCGAGGG - Intronic
1087605870 11:100377013-100377035 GGATGGGGGAGAGGGGGAGAGGG + Intergenic
1088645153 11:111912002-111912024 GGGTGGGGGTGGGTGCCATTGGG - Intronic
1088645372 11:111912942-111912964 GGGTGGGGGTGGGGGGCAAGGGG - Intronic
1088807650 11:113366890-113366912 GGCTGGAGGAGGGTGCCAGAGGG - Intronic
1088908308 11:114171351-114171373 GGATGGGGGTGGAGTTCAGTGGG - Intronic
1088918311 11:114243569-114243591 GGACGGAGGTAGGGCCCAGAGGG + Intronic
1088939213 11:114436662-114436684 GGATGGGGGTGGGGGAGTAATGG + Intronic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089121392 11:116138146-116138168 GGATGAGGGTTGGGGGCAAAGGG + Intergenic
1089170434 11:116507874-116507896 ATATGGGGGTGGGAGCCTGAAGG - Intergenic
1089215245 11:116830902-116830924 GGATGGGGAGGGAGGCCAGCGGG - Intronic
1089353071 11:117832281-117832303 GGAAGGAGGTGGGCCCCAGAGGG + Intronic
1089371219 11:117959750-117959772 GGGTGGGGGTGGAGGTCAGTGGG + Intergenic
1089400827 11:118163652-118163674 AGATGGGGGGTGGGGGCAGAGGG + Exonic
1089461384 11:118656247-118656269 GGACTGGGGTGGGCACCAGAGGG - Intronic
1089499175 11:118922682-118922704 CGATGGGGGGAGGGGGCAGAAGG - Intronic
1089653611 11:119931547-119931569 GGAAGGAGGTGGGGGAGAGAAGG - Intergenic
1089687904 11:120168771-120168793 GGAGGGAGGTGGTGGCGAGAGGG - Intronic
1089943312 11:122441597-122441619 AGAAGGGGGTTGGGGGCAGAGGG + Intergenic
1090022279 11:123138589-123138611 GGAGGGGGGTGGGGGGCAGGTGG - Intronic
1090406126 11:126476648-126476670 AGATGGGGGTGGGGGCTGGGGGG + Intronic
1091339337 11:134798263-134798285 GGATGGGGGTGTGGACCACGTGG + Intergenic
1202808182 11_KI270721v1_random:15950-15972 GGAGGTGGGTGGGGGCAGGATGG - Intergenic
1091719366 12:2801361-2801383 GGATTGGGGTGGGGAACAGTTGG + Intronic
1091844746 12:3647185-3647207 AGGTGGGGGTGGGGGACAGCGGG - Intronic
1091889968 12:4045496-4045518 TGGTGGGGGTGGGGGCAAGGCGG - Intergenic
1091961922 12:4702974-4702996 TGATGAGGGAGGGGGCCAGGTGG + Intronic
1092111279 12:5966580-5966602 GGGAGGGGGTGGGGGCCAAGAGG - Intronic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092240015 12:6830511-6830533 GGATGGGGCTGCGAGCCAGGGGG + Exonic
1092241857 12:6840508-6840530 GGATGGGGGCCGGGACCAGGGGG + Intronic
1092592198 12:9962624-9962646 GGACAGGAGTGGGGGCCACAAGG + Intronic
1093281690 12:17203727-17203749 GGATGGGGGGGGGGGTCACAGGG - Intergenic
1093990084 12:25580233-25580255 GGATGGAAGGAGGGGCCAGAGGG - Intronic
1094208547 12:27866347-27866369 GGGTGGGGGTAGGGGGGAGATGG + Intergenic
1094216090 12:27944332-27944354 TCATGGTGGTGGGGGCCGGAGGG + Intergenic
1094375536 12:29784184-29784206 GGATGGGGGCGGGGGCGTGGGGG - Intronic
1094650240 12:32369237-32369259 GGATGGAGGTGAGGTCCTGATGG - Intronic
1095491058 12:42734229-42734251 AGATGGGGGTGGGGGCGGGGTGG + Intergenic
1095825223 12:46524121-46524143 GGGTGGGGCTGGGAGCTAGAAGG + Intergenic
1095990242 12:48029589-48029611 GGATGGGGGAGGGGGCGCCAAGG - Intergenic
1096257783 12:50073524-50073546 GGAAGGGGGAAGGTGCCAGAGGG - Intronic
1096436152 12:51592042-51592064 GGGTGGGGGTGGGGGTGGGATGG - Intronic
1096558904 12:52422062-52422084 CAATGGGGTTGGGGGACAGATGG + Intergenic
1096648970 12:53052755-53052777 GGATGGGGGTGGGGAAGAGGAGG + Intronic
1096807415 12:54149034-54149056 GGTTGGGGGTGGGAGCCACTGGG - Intergenic
1096887956 12:54736434-54736456 GGGTAGGGGTGGGGGTCACAAGG - Intergenic
1097051352 12:56224964-56224986 GGATGGGGGTCGGGGGCAGGAGG + Intronic
1097174659 12:57135821-57135843 AAATGGGGGTGGGGGACAGCGGG + Intronic
1097175165 12:57138336-57138358 GGCTGAGGGTCTGGGCCAGATGG + Intronic
1097296191 12:57965561-57965583 GGGTGGGGGTGGGGGCATGAGGG + Intergenic
1097680907 12:62647982-62648004 GAAGGGGGGCGGGGGGCAGACGG + Exonic
1097768986 12:63558434-63558456 GGGTGGGGGTGGGGGGCAAGGGG - Intergenic
1098988641 12:77040681-77040703 GGATGGGAGTGGGGACCAGGAGG + Intronic
1099140492 12:78968371-78968393 TGAGGGTGGTGGGGGCTAGAGGG - Intronic
1099814430 12:87626779-87626801 GGATGGTGATGGGGGACAGATGG - Intergenic
1100039462 12:90296277-90296299 GGATGGGGGATGGGGGTAGAGGG - Intergenic
1100386473 12:94109043-94109065 GGTCGGGGGTGGGGGGCAGTGGG - Intergenic
1100565254 12:95789539-95789561 GGATGGGAGTGGGAGGGAGAGGG + Intronic
1101291035 12:103369574-103369596 GGATAGGGAAGGGGGTCAGAAGG + Intronic
1101408231 12:104447704-104447726 GGAAGGGGATGGGGGACAGAAGG - Intergenic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1101849127 12:108388368-108388390 GGATATGGGTGGGCTCCAGAGGG - Intergenic
1101948344 12:109155037-109155059 GGATGGGGGTGGGGGTAAAGGGG - Intronic
1102012871 12:109629566-109629588 AGATGGGGGTGGTGGCAAGATGG - Intergenic
1102197834 12:111036888-111036910 GGGTGGGGGTGGGGGGCTGCGGG - Intronic
1102301395 12:111774162-111774184 GGGTGGGGGAGTGGGGCAGAGGG + Intronic
1102483760 12:113242351-113242373 GGCTGGGGGTGTAGGCCAGGCGG - Intronic
1102548002 12:113670473-113670495 GGGTGGGGGTCTGGGCCAGGGGG + Intergenic
1102713876 12:114952981-114953003 CGCTCGGGGTTGGGGCCAGAGGG - Intergenic
1102740971 12:115207295-115207317 AAGTGGGGGTGGGTGCCAGAGGG - Intergenic
1102760451 12:115380479-115380501 GGATGGGGGTGGGGGATTGTGGG + Intergenic
1102846965 12:116195261-116195283 TGGTGGGGGTGGGGGCAACAGGG + Intronic
1103216803 12:119208010-119208032 GAATGGGGGTTGGGGGAAGAGGG - Intronic
1103328424 12:120137134-120137156 GGACAGGGGTAAGGGCCAGAAGG + Intronic
1103443526 12:120979958-120979980 GGATGGGGGTGTGGGGGAGAAGG + Intronic
1103905944 12:124327197-124327219 GGCCGGGGCTGGGGGGCAGAGGG + Intronic
1103953529 12:124564905-124564927 GCCTGGGGGTGGGGGGCAGGGGG - Intronic
1103994349 12:124819548-124819570 GGTTGAGGGTGGGGGTCAGGTGG - Intronic
1104041442 12:125133865-125133887 GCATGGGGCTGGGGGCCAGAGGG - Intronic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104323490 12:127773997-127774019 AGATGGTGGTGTGGACCAGATGG - Intergenic
1104600593 12:130150793-130150815 GGAGTGGGGTGTGGGCTAGATGG + Intergenic
1104733683 12:131122934-131122956 GGTAGGGGGTGGGGCCCTGAAGG - Intronic
1105204276 13:18207055-18207077 GGATGGGGTTGGGGGCCTCTCGG + Intergenic
1105210677 13:18255029-18255051 GGAAGGTTGTGGGTGCCAGAGGG - Intergenic
1105458905 13:20566276-20566298 GGATGGAGGGGAGGGACAGAGGG - Intergenic
1105497493 13:20943732-20943754 GGCTGGGGGTGGGAGCCACCTGG - Intergenic
1105514150 13:21075932-21075954 GGGGGGGGGCGGGGGCCGGAGGG - Intergenic
1105514184 13:21076003-21076025 TGAGGAGGGTGGGGGCCGGAGGG - Intergenic
1105533637 13:21243526-21243548 GGAGGAGGGTGAGGGCCAGAGGG + Intergenic
1105804917 13:23947163-23947185 AGAGGGGAGTGGGGGCCAGAGGG - Intergenic
1105951094 13:25230082-25230104 AGAAGGTGGTGGTGGCCAGACGG - Intergenic
1106061369 13:26295854-26295876 GGCTGGGGGTGGGGAGAAGATGG + Intronic
1106327716 13:28710176-28710198 GAATGGGGGTGGGCTCCAGCTGG - Intronic
1106402848 13:29446020-29446042 GGATGGGGCTGGTCACCAGAAGG - Intronic
1106440948 13:29769536-29769558 AGATGGGGGTTGGGGAGAGAGGG + Intronic
1106931306 13:34668630-34668652 CGACGGGGGTGGGGGTCAGGAGG - Intergenic
1107394137 13:39997489-39997511 GGATGGAGATGAGGGGCAGAAGG + Intergenic
1107459808 13:40591021-40591043 GGATGGGGCCTGGGGACAGATGG + Intronic
1107886811 13:44880644-44880666 GGGTGGGGGGGGGGGCAATAAGG - Intergenic
1108373222 13:49791901-49791923 AGAGGGGGGTGGGGACCAGCCGG - Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1112663885 13:101545182-101545204 GCATAGGGGTGGGGCCAAGATGG - Intronic
1112802123 13:103124302-103124324 GCATGGTGGTGGTGGCCACATGG + Intergenic
1113617327 13:111690055-111690077 GGATAAGGGAGGGGACCAGATGG + Intergenic
1113622856 13:111775325-111775347 GGATAAGGGAGGGGACCAGATGG + Intergenic
1113723971 13:112583788-112583810 GGATGGGGGAGGGGTCAGGAGGG + Intronic
1113772673 13:112920649-112920671 GGTTGTGGGTGGGTGCCAGGGGG + Intronic
1113935113 13:113989771-113989793 GGATGGGTGTGCTGGACAGATGG - Intronic
1114269914 14:21094284-21094306 TGAAGGGGGAGGGAGCCAGAGGG + Intronic
1114567453 14:23643228-23643250 GGGCGGGGGTGGGGACCAGTCGG + Intronic
1114696914 14:24634066-24634088 GGATGGGGTTGGGCCCCCGAGGG + Intronic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1115576127 14:34714290-34714312 GGTTGGGGGTCGGGGCCGGGCGG - Intronic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1116930086 14:50682176-50682198 GGAGGGTGGTGGGGGTCTGAGGG - Intergenic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117656334 14:57960378-57960400 GGAAGGGGGAGGGGAACAGAAGG - Intronic
1117781678 14:59239627-59239649 GGATCGGGGTGGGGGCGCGGTGG - Intronic
1117893327 14:60450394-60450416 TGATGGTCGTGGGGGCCACAGGG + Intronic
1118362636 14:65069240-65069262 GGCTGGGGGTGGGGGGCTGTTGG - Intronic
1119314735 14:73683610-73683632 AGAGGGGGGTGGGGGGCTGAGGG - Intronic
1119505273 14:75167421-75167443 TGGTGGGGGTGGGGGCGAGGAGG - Intronic
1119525727 14:75320876-75320898 GGTGGGGAGTGGGGGACAGACGG - Intergenic
1119578849 14:75755980-75756002 GGGTGGGGGTGGGGGGCGGTGGG - Intronic
1119895909 14:78219918-78219940 GGATGGGGATGGAGGGTAGAAGG + Intergenic
1119916490 14:78406787-78406809 GGTTGGAGGTGGGGGTGAGAGGG + Intronic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120250473 14:82057080-82057102 GGGTGGGGGGAGGGGCCAGGTGG + Intergenic
1120273783 14:82347546-82347568 GGATGGGGGAGGAGCCAAGATGG + Intergenic
1120389184 14:83883742-83883764 GGTTGGGAGTGGAGGCTAGATGG - Intergenic
1120744004 14:88137570-88137592 AGATGGGGGATGGGGTCAGAAGG - Intergenic
1120843573 14:89107495-89107517 GGATGTGGGTGGGGGCAACTTGG - Intergenic
1120905359 14:89616200-89616222 GGTTGGGGGTGGAGGCTAGGGGG + Intronic
1120993480 14:90397887-90397909 GGGTGGGGTTGGGGGCAGGAAGG + Intronic
1120996469 14:90421879-90421901 GGCAGGGGGTAGAGGCCAGAGGG - Intergenic
1121488861 14:94343594-94343616 GGTTAGGGGTGGGGGCAAGGAGG + Intergenic
1121629697 14:95413338-95413360 GGACGGGGAAGTGGGCCAGAGGG - Intronic
1121667965 14:95686691-95686713 GGACCGCGGTGGGGGTCAGAGGG + Intronic
1121994732 14:98593209-98593231 GGATGGAGAAGGGGGCCTGAGGG - Intergenic
1122214509 14:100193960-100193982 GGGTGGGGGTGGGGGTGGGAAGG + Intergenic
1122373705 14:101243989-101244011 GGATGGGGTTGGGGAGAAGAAGG - Intergenic
1122375777 14:101256078-101256100 GGATGAGGATGGGGAACAGAAGG - Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122525036 14:102375850-102375872 AGAAGGGACTGGGGGCCAGAGGG - Intronic
1122588952 14:102831640-102831662 GGCTGGGGCTGGGAGACAGAAGG - Intronic
1122696273 14:103554302-103554324 GGGTGGGGGTGGGGGTCACCAGG - Intergenic
1122763671 14:104049806-104049828 GGATGGCTTTGGGGGCCAGCTGG + Intronic
1122791440 14:104185660-104185682 GGATGGGGTTGGGGTACGGATGG + Intergenic
1123035613 14:105470779-105470801 CGATGGGGGTGGGGGGCCCAGGG - Intergenic
1123053848 14:105560137-105560159 GGAAGGGCCTGGGGGTCAGAGGG + Intergenic
1123078431 14:105680554-105680576 GGAAGGGCCTGGGGGTCAGAGGG + Intergenic
1202902151 14_GL000194v1_random:50183-50205 GGAGGGGAGTGGGGGTCTGAAGG + Intergenic
1123448447 15:20345682-20345704 GGATGGGGGTGGGGTGGCGAGGG + Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124208999 15:27746793-27746815 GGATGGGGATGTGGGAGAGAGGG - Intergenic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124532313 15:30518404-30518426 TGATGAGGGTGGGGCCCTGAGGG + Intergenic
1124766340 15:32489241-32489263 TGATGAGGGTGGGGCCCTGAGGG - Intergenic
1125181819 15:36887454-36887476 AGGTGGGGGTGGGGGCGAAAGGG + Intergenic
1125200000 15:37095163-37095185 GGCTGGGGGTGGGGGCTGGGGGG - Intronic
1125363889 15:38893012-38893034 TGTTGGGGGTGGGGGGCAGGGGG + Intergenic
1126838151 15:52688559-52688581 GGATGGGGGTTGGGGAGAAAAGG + Intronic
1127572820 15:60261019-60261041 AGATTGGGGAGGGGGTCAGAAGG + Intergenic
1128264429 15:66254243-66254265 GGATGGGAGTGGGGGTCTGGGGG + Intergenic
1128293474 15:66497273-66497295 GGAAGGGGTCGGTGGCCAGAGGG + Intronic
1128510484 15:68311246-68311268 GGCTAGGGGAGGGGACCAGAAGG - Intronic
1128535518 15:68487111-68487133 GGATGGGGGCAGGGGAAAGAAGG - Intergenic
1128657162 15:69470723-69470745 GGGTGGGGGTGAGGGGCAGAAGG - Intergenic
1129204065 15:74024952-74024974 GGGTGGTGGTGGGGCCCAGCAGG + Intronic
1129290501 15:74563265-74563287 GGATGGGGGTGTGGACCTGGAGG + Intronic
1129339415 15:74875271-74875293 GGTGGGGGTTGGGGGCTAGAAGG - Intergenic
1129394635 15:75237243-75237265 GGATGGGGGTTGGGCCCCGAGGG + Intergenic
1130305239 15:82709095-82709117 AGATGGAGATGGGGACCAGAGGG + Intronic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1130583076 15:85155733-85155755 AGATGAGGGTGCGGGCCAGGAGG - Intergenic
1130829796 15:87587529-87587551 AGATAGGGGTGGTGCCCAGAAGG + Intergenic
1130844823 15:87734807-87734829 GGAGGCGGGTGGGGCCAAGAGGG - Intergenic
1130921320 15:88347534-88347556 GGCTGAGGGTGGGGGCAGGAGGG - Intergenic
1130961192 15:88659640-88659662 GGATGGGGCTGGGGGACAGTGGG - Intergenic
1130991151 15:88876905-88876927 GGGTGGGAGTGGGAGGCAGAGGG + Intergenic
1131048536 15:89331761-89331783 GGGTGGGGGTGGGTGCCACATGG - Intronic
1131052314 15:89357046-89357068 AGAAGGGGGTTGGGGTCAGAGGG + Intergenic
1131463720 15:92637983-92638005 GGGTGGTGCTGGGGGCCAGTGGG + Intronic
1131583877 15:93672607-93672629 GGGTGGGGGTGGGGGGCGGGGGG + Intergenic
1132045184 15:98557638-98557660 GGGTGGGGGGGGGGACCACAGGG + Intergenic
1132056559 15:98655089-98655111 GGATGGGGGTGCAGGCATGAGGG - Intronic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1132358192 15:101189252-101189274 GCACGGGCGTGGAGGCCAGAGGG - Intronic
1132589490 16:720537-720559 GGATGGGGGGTGGGGTCTGAGGG - Intronic
1132647383 16:1005186-1005208 AGATGGGGGGAGGGGACAGAGGG + Intergenic
1132691415 16:1183399-1183421 GGCTGGGGGGAGGGGCCAGGAGG - Intronic
1132700180 16:1218898-1218920 GGACGGGGGTGGGTGGCAGCTGG + Intronic
1132709166 16:1258860-1258882 GGATGGAGGAGGGGGCAGGATGG - Exonic
1132933353 16:2469547-2469569 GGTGGGGGTTGGGAGCCAGAAGG + Intergenic
1133027563 16:2995370-2995392 AGATGGAGGTGGGGGTGAGAGGG - Intergenic
1133210361 16:4260215-4260237 GGTGGTGGGTGGGGGCCGGAGGG + Exonic
1133239907 16:4408105-4408127 GGATGGCGCTGGGGCTCAGAAGG + Intronic
1133344654 16:5061786-5061808 TGATGGGAGTGGGGAGCAGAGGG + Intronic
1133771864 16:8871237-8871259 GGGTGGGGGTGCGGGCTAGACGG + Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133995390 16:10744190-10744212 GGAGAGGGGTGGGGCCCAGAAGG + Intronic
1134050257 16:11132236-11132258 GGATGGGGGCGGGGGCGGGGGGG - Intronic
1134059832 16:11192418-11192440 GGGTGAGGGTGGAGGCCAGGAGG + Intergenic
1134108246 16:11499165-11499187 GGAGGGGGGAGGGAGGCAGAGGG + Intronic
1134489711 16:14687555-14687577 GGCTGGGGGTGGGGACCAGAAGG - Intronic
1134815776 16:17204544-17204566 GGATGGGGATGGGGGGCAGAGGG + Intronic
1135043553 16:19136239-19136261 GGAGGGGGCTGGGGGGCAGGTGG - Intronic
1135304191 16:21354718-21354740 GCATGGGGGTGGGGAGGAGAGGG - Intergenic
1135872833 16:26166761-26166783 TGATGGGTGTGTGGGCCAAATGG - Intergenic
1135948070 16:26882962-26882984 TGTTGGGGGTGGGGGACAAAAGG + Intergenic
1136030551 16:27499642-27499664 GGTTGGGGGTGGGGGCAGGGTGG - Intronic
1136248542 16:28989114-28989136 GGATGGGGGTCGGGGGGAGGAGG + Intronic
1136300932 16:29333855-29333877 GCATGGGGGTGGGGAGGAGAGGG - Intergenic
1136411992 16:30083003-30083025 TGATGGGGGTTGAGGCCAGCGGG + Intronic
1136456131 16:30380838-30380860 GACACGGGGTGGGGGCCAGAGGG + Intronic
1136499756 16:30664442-30664464 GGGTGGGGGTGGGGGCAGGGTGG - Exonic
1137554440 16:49461698-49461720 GGGTGGAGGTGGGGGCCACAGGG + Intergenic
1137626238 16:49910555-49910577 GGAAGGGGGAGGGGGGCACATGG - Intergenic
1137756496 16:50906452-50906474 GGAGGGGGGCGAGGGCCAGGAGG - Intergenic
1137783058 16:51114050-51114072 GGATGGGGGTGGGGGCGAGGAGG + Intergenic
1138250195 16:55496279-55496301 GAATGGGGGTAGGGGACACAGGG + Intronic
1138440832 16:57034142-57034164 GGGTAGGAGTGGGGGACAGAAGG - Intronic
1138506088 16:57479025-57479047 GGCCGGGGGTGGGGGGCAAACGG + Intronic
1138548834 16:57736044-57736066 GGGTCGGGGTGGAGGCCGGAGGG + Intronic
1138550066 16:57742928-57742950 GGATGGGGGTTGGGGCAGGGAGG - Intronic
1139236542 16:65345486-65345508 GGATGGCGGTGGTGGAGAGAGGG - Intergenic
1139291972 16:65867591-65867613 GTGTGGGGGTGGGGGCTGGAGGG - Intergenic
1139422064 16:66854957-66854979 GGAGGGAGGTGGGAGACAGAGGG + Intronic
1139527420 16:67525467-67525489 GGATGGGGGTGGGGGTTGCATGG + Intronic
1139719335 16:68840296-68840318 GCATGGTGGAGGTGGCCAGATGG - Intergenic
1140200618 16:72891778-72891800 GGCTGGGGGTTGGGGACAGGTGG - Intronic
1140457370 16:75113132-75113154 GCTTGGGGGTGGGAGCCACAGGG - Intronic
1140473112 16:75225947-75225969 GGGTGGGGGTAGCGGCCAGAGGG - Intergenic
1140490006 16:75327447-75327469 GAATGGGGGAAGGGGACAGAAGG + Intronic
1140584277 16:76270295-76270317 GGAGAGGGGTGGGGGCAAGTGGG + Intergenic
1140974380 16:80044899-80044921 GGATGGGGGGGGGGGGCAGGTGG + Intergenic
1140980413 16:80103791-80103813 GGGTGGGGGTGGTGGACGGATGG - Intergenic
1141036707 16:80632997-80633019 GGTAAGGGGTGGCGGCCAGAGGG - Exonic
1141677306 16:85524551-85524573 GGGTGAGGGTGGGGTCCAGGGGG + Intergenic
1141679632 16:85536670-85536692 GGCAGGGGCTGGGAGCCAGAGGG - Intergenic
1141689394 16:85587833-85587855 GGCTGGGGGAGGGGGCCCAAGGG - Intergenic
1141690617 16:85594230-85594252 GGTTGGGGGGGGGGGGCGGAGGG + Intergenic
1141731792 16:85827880-85827902 GCATGGGGGTGGGGGCCCCCAGG + Intergenic
1141897035 16:86964827-86964849 TGGCGGGGGTGGGGGCGAGAGGG - Intergenic
1141961605 16:87412829-87412851 GGCAGGGGGTGGTGGCCTGATGG + Exonic
1142062632 16:88040584-88040606 GCATGGGGGTGGGGAGGAGAGGG - Intronic
1142073270 16:88103132-88103154 GGGAGGGGGGAGGGGCCAGAAGG - Intronic
1142252628 16:88999674-88999696 GGGAGGGGGCGGGGGGCAGAGGG + Intergenic
1142252653 16:88999723-88999745 GGAGGGGGGGGCGGGGCAGAGGG + Intergenic
1142274106 16:89106877-89106899 GGATGGGGTTGGGGGAGAGGAGG + Intronic
1142286491 16:89173513-89173535 TGGTGGAGGTGGGGGCCAGATGG + Intronic
1142361882 16:89631227-89631249 GGTCGGGGGTGGGGGCCGGGTGG - Intronic
1142551381 17:742172-742194 GGCTGGGGGTGGGGGCAGGCAGG + Exonic
1142674766 17:1506953-1506975 GGAGGGAGTGGGGGGCCAGAAGG - Intronic
1142875929 17:2852340-2852362 GGGTGGGGGTGGGGGGCACAAGG + Intronic
1142961824 17:3556364-3556386 GGACGGGGAAGGGGGCCAGCTGG + Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143000358 17:3790768-3790790 GGATGGGGGTGCACTCCAGACGG + Intronic
1143012845 17:3875784-3875806 GGCTCAGGGTGGGGGGCAGAGGG - Intronic
1143030221 17:3963667-3963689 GGGTGGGGGTGGGGGCCCCAAGG + Intronic
1143164300 17:4890188-4890210 GGTGTGGGGTGGGGGGCAGAGGG - Intronic
1143478765 17:7217267-7217289 GGATGGGGGGAGGGGTGAGAGGG + Intronic
1143517156 17:7425633-7425655 GGCCGGGGGTGGGGGGCAGAGGG + Exonic
1143632296 17:8146219-8146241 GGATGGTGGTAGGGAACAGAGGG + Intronic
1143741926 17:8960831-8960853 GGCTGGGGGTGGGGCCCGGAGGG - Intronic
1144576275 17:16431860-16431882 GGAAGGGGGAGGGGGCCGGAGGG - Intronic
1144627330 17:16850896-16850918 GGTTGGTGGTGGGGGCAAGGCGG - Intergenic
1144848122 17:18230583-18230605 GGGTGGGGGTGGGGGCAGGCCGG + Intronic
1144879107 17:18421816-18421838 GGTTGGTGGTGGGGGCAAGGCGG + Intergenic
1144956126 17:19019738-19019760 GGCTGGTGGTGGGGGCCACGAGG + Exonic
1145153127 17:20522571-20522593 GGTTGGTGGTGGGGGCAAGGCGG - Intergenic
1145259854 17:21348217-21348239 GGATGTGGTTGGGGCACAGATGG + Intergenic
1145316761 17:21739721-21739743 GGATGTGGTTGGGGCACAGATGG - Intergenic
1146514627 17:33479799-33479821 GGATTGGGGAGGGGGGCACAGGG - Intronic
1146622701 17:34411853-34411875 GGATGGGGGTGGGGGAAGGCTGG + Intergenic
1146942027 17:36849984-36850006 GGATGGGGGCGGGAGCGTGAAGG + Intergenic
1146967765 17:37047477-37047499 GGAGAGGGATGGGGGCGAGAAGG - Intronic
1147017760 17:37506258-37506280 GGACGGGGGCGGGGGGGAGATGG - Intronic
1147168488 17:38605382-38605404 GCCCCGGGGTGGGGGCCAGAGGG - Intronic
1147188531 17:38725782-38725804 GGAAAGGGAAGGGGGCCAGATGG - Exonic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147303059 17:39545184-39545206 AGATGGGGTTGTGGGCTAGAGGG - Intronic
1147364891 17:39953080-39953102 GGGTGGGGCTGGGGCCGAGACGG + Intergenic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1147419289 17:40314187-40314209 GGGTGGGGGTGGGGACGAGCTGG + Intronic
1147420939 17:40321928-40321950 GGATGGGGGTGGGGGTCATCAGG - Intronic
1147752437 17:42744701-42744723 GGATGGCGGTGTGGGCCGGTGGG - Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147833748 17:43315387-43315409 GGAAGGGGGTGGGGGGCGGCGGG + Intergenic
1147944018 17:44070182-44070204 GGATGGGGGTGGGGGAAGCAAGG + Intergenic
1148326147 17:46784530-46784552 GGAGGGGGCTGGGGGCCAAGGGG + Intronic
1148443716 17:47725471-47725493 AGCTGGGAGTGGGGGCAAGAAGG - Intergenic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148460958 17:47838755-47838777 GGAGGGGGCTGGGGGCCAGGAGG - Intronic
1148464759 17:47858160-47858182 GGCTGAGGATGGGGGCCGGAGGG - Intergenic
1148555487 17:48576643-48576665 GGATGGGGTGGGGGGACAGGAGG - Exonic
1148629070 17:49092615-49092637 GGGCGGGGGTGGGGGGCACATGG + Intergenic
1148674691 17:49438568-49438590 GGATGGGGGAGGGGGCCGGGGGG + Intronic
1148688459 17:49513494-49513516 GGCTGGGGTGGGGGGCAAGAGGG - Exonic
1148743381 17:49905565-49905587 GGGTAGGAGTGGGGGCAAGAAGG - Intergenic
1148793194 17:50185001-50185023 GGCTGAGGGTGGGGGCCACTTGG + Exonic
1148807095 17:50269392-50269414 GGTGGGGGGTGGGGGTCAGGTGG + Intergenic
1148853134 17:50564460-50564482 GGAGTGGGAGGGGGGCCAGAGGG + Intronic
1148895490 17:50836841-50836863 TGATGGGGGTGGGAGCCACAGGG + Intronic
1149100486 17:52900564-52900586 GAATCGGGGAGGGGGACAGACGG + Intergenic
1149312431 17:55407650-55407672 GGCTGAGGGTGGGGACAAGAGGG + Intronic
1149492275 17:57093759-57093781 TAATGGGGGTGGGGGGCAGTGGG - Intronic
1150129175 17:62657667-62657689 GGATGGGGGTGGGGGGCATCAGG + Intronic
1150227072 17:63530050-63530072 GGATGGGGGGTGGGCCCTGAAGG - Intronic
1150491919 17:65580236-65580258 GGAAGTGGGTGGGGGTCACATGG - Intronic
1151062152 17:71107765-71107787 GAATGGGGGTAGGGGTGAGAAGG + Intergenic
1151448337 17:74181830-74181852 GGCAGAGGCTGGGGGCCAGAGGG - Intergenic
1151568839 17:74916015-74916037 GGGTGGGGGTGGGGGCGGGAGGG - Intergenic
1151658659 17:75507552-75507574 GGGTGGGGGTCGGGGGCACATGG + Intronic
1151716370 17:75833082-75833104 GGATGGGGGTGGGGCCAACATGG - Intronic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1151762320 17:76112283-76112305 GGTTGGGGGAGGGAGACAGAGGG + Intronic
1151843683 17:76636233-76636255 GTATGGGGGTGGGGTGGAGAGGG - Intronic
1151956201 17:77381395-77381417 GGGTGGGGGGTGGGGACAGAAGG - Intronic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152196812 17:78923393-78923415 GGGTGGGGGGGGGGGCGGGAGGG + Intronic
1152210457 17:79000489-79000511 GGATGTTGGTGGGGGGCAGCTGG - Intronic
1152229385 17:79106891-79106913 GGATGGGGGAGAGGCCCAGAAGG - Intronic
1152234632 17:79132273-79132295 GGGGTGGGGTGGGGGGCAGAGGG + Intronic
1152257178 17:79246859-79246881 GGATGGGGGTGGGGGGAGAACGG + Intronic
1152340343 17:79720900-79720922 GGATGGGGGTGGGGTGTCGAGGG - Intergenic
1152650622 17:81490881-81490903 AGAGGGGGCTGGGGGCCAGGTGG + Intergenic
1152695311 17:81741146-81741168 GGTTGGGGGGGGTGCCCAGAGGG - Intergenic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152757978 17:82094979-82095001 TGGTGGGGGTGGGGGCCTGGAGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152859097 17:82685249-82685271 GGAGGGGGAAGTGGGCCAGAAGG + Intronic
1153233565 18:2964345-2964367 TGGTGGTGGTGGGGGACAGAGGG - Intronic
1153424295 18:4945428-4945450 GAATGGGGGTGGGGCTCACAGGG - Intergenic
1153530273 18:6039042-6039064 GCATGGGGCTGGGGGAGAGAGGG - Intronic
1153664074 18:7352383-7352405 GGATGGGGGCAGGGGACACATGG - Intergenic
1153664749 18:7358878-7358900 AAATGGGAGTGGGGACCAGAAGG + Intergenic
1154082067 18:11267408-11267430 GTATGGGGGTGGGAGCAAGCAGG + Intergenic
1154335924 18:13464772-13464794 GGGTGGGGGTGGGGGCTGAAGGG - Intronic
1155003451 18:21707380-21707402 GGATGTGGGTGGGGCCGATAAGG + Intronic
1155966733 18:32042775-32042797 GTATGGGGGTAGGGGAAAGATGG + Intronic
1156109248 18:33703656-33703678 GGATGGGGGTGGGGGTTGGGGGG - Intronic
1156179204 18:34583323-34583345 GTTTGGGGGTGGGGGCCAACGGG - Intronic
1156231184 18:35155409-35155431 GGATGGGGGTGGGTGGAGGAGGG + Intergenic
1157037326 18:43990647-43990669 GGATGGAGCTGGAGGCCATAAGG - Intergenic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157426327 18:47587536-47587558 GGATGGCGTTGCGGGGCAGAAGG - Intergenic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1157574832 18:48736598-48736620 TGATGGGGGTTGGGGGAAGAAGG + Intronic
1157821643 18:50775768-50775790 CGATGGGGGTGGGGGGCGGTAGG - Intergenic
1158089174 18:53690679-53690701 GGGTGGGGGTGGGTCACAGAAGG - Intergenic
1158650064 18:59276173-59276195 TGATGGGGGTGGGGGAGACAGGG + Intronic
1160048233 18:75407360-75407382 GGATGGGGGTGGGGAGGAGTAGG + Intronic
1160176066 18:76595349-76595371 GGATGGGGGTAGGGGGAAGTAGG + Intergenic
1160367454 18:78339606-78339628 GGCTGGGAGTGGGAGGCAGAAGG - Intergenic
1160530420 18:79559133-79559155 GGATGGAGTTGGGAGCAAGAAGG + Intergenic
1160744285 19:703583-703605 GGGTTGGGGTGGGGGCCATAAGG + Intergenic
1160963437 19:1734946-1734968 GGATGGGGCAGGGGCCCAGGAGG + Intergenic
1160970160 19:1764438-1764460 GGAGAGGGGTGGGGACAAGAGGG + Intronic
1160984392 19:1831497-1831519 GGGTGTGGGTGGGGGCCATAGGG - Intronic
1161015082 19:1979426-1979448 GGTGGGGGGTGGGGGGCACAGGG - Intronic
1161028257 19:2046513-2046535 GCAGGGGGGTGGGGGCCGGCCGG - Intronic
1161028812 19:2048670-2048692 GGAGATGGGTGGAGGCCAGAGGG + Intronic
1161056880 19:2195133-2195155 GGATGGGTGTGGGGGTGGGAAGG + Intronic
1161161746 19:2765506-2765528 GGATGGAGGTGGGGGCGGCAGGG + Intronic
1161217376 19:3101155-3101177 GGAGTGGGGTGGGGGGCTGAAGG + Intronic
1161255916 19:3309435-3309457 GGTTGGGGGTGTGGTGCAGATGG + Intergenic
1161287646 19:3477178-3477200 GGATGGGGGTGGGTGATGGATGG + Intronic
1161307117 19:3574268-3574290 GGATGGGGGCGGGGCCTAGCTGG - Intronic
1161326659 19:3667527-3667549 TGATGAGGGTGGGGGCCACTGGG + Intronic
1161329808 19:3681134-3681156 GGATGGGAGTGGGGGCGGGCAGG + Intronic
1161351963 19:3798370-3798392 GGGTGGGGGTGGGGGTCACTGGG + Intronic
1161366074 19:3880607-3880629 GGTGGGGGGTGGCGGCCTGACGG - Exonic
1161369189 19:3900418-3900440 GGATGGGGTTGTGGGGCAGAAGG - Intronic
1161398722 19:4058498-4058520 GGGTGGGGACAGGGGCCAGAGGG - Intronic
1161449089 19:4334653-4334675 GGATGGGGGTGATGGACGGATGG - Intronic
1161501007 19:4615721-4615743 GGAGGGAGGTGGGAGCCAGAGGG - Intergenic
1161711471 19:5851035-5851057 TGATGGGGTTGGGGTGCAGAGGG + Intronic
1161779313 19:6280222-6280244 GGAGGGGGGCGGGGGCGGGACGG + Intergenic
1161978111 19:7617284-7617306 GGATGGAGGTGGGGTCAGGATGG - Intronic
1161978166 19:7617503-7617525 GGGAGGGGGTGGGGGGCAGCAGG - Intronic
1161979674 19:7624021-7624043 GGCTGGGGGTGGGGCTCAGGTGG - Intronic
1162032880 19:7925016-7925038 AGTCGGGGGTGGGGGCCAGCCGG + Exonic
1162037804 19:7951770-7951792 GGTGGGGGCTGGGAGCCAGAGGG - Intergenic
1162327920 19:10009608-10009630 GGGTGGGGGAGGGGGCAACAGGG + Intronic
1162343265 19:10105242-10105264 GGCTGAGGGTGGGGGGCCGAGGG - Intergenic
1162393984 19:10405448-10405470 GGATGGGGACCGGGGACAGAGGG - Intronic
1162440538 19:10689402-10689424 GGATGGGGGCGGGGGCCTGGAGG - Exonic
1162504965 19:11078232-11078254 AGATGGGGGTGGGGGCGTGGGGG - Intergenic
1162539317 19:11284679-11284701 GGAAGGGGGTGGGGGCAGGGGGG - Intergenic
1162585545 19:11556005-11556027 TGATGGGGTTGGGTGGCAGAGGG + Intronic
1162788763 19:13052349-13052371 GGCTGGGGGTAGAGCCCAGATGG + Intronic
1162888450 19:13714053-13714075 TGATGTGGGTGGGGACCAGCTGG - Intergenic
1162904578 19:13816114-13816136 ATATGGGGGTGGGGGACAGGAGG + Intronic
1162940510 19:14006207-14006229 GGGTGGGGGTGGGGGTCGGCCGG + Exonic
1163091538 19:15023346-15023368 GGATGGATTTGGGTGCCAGATGG + Intergenic
1163152089 19:15421710-15421732 GCATTTGGGTGGGGGCCAGTGGG - Exonic
1163170425 19:15527307-15527329 GGATGGAGGTTGGAGCCAAAAGG - Intronic
1163422149 19:17219840-17219862 AGATGGGGGCAGGGGACAGACGG - Intergenic
1163463888 19:17455239-17455261 GGATGGGGGTGGGGGGGTGGGGG - Intronic
1163551464 19:17968088-17968110 GGGTGGGGGTGGTGGCGGGAAGG + Intronic
1163561184 19:18020507-18020529 GGGTGGGGGTGGGGGTGGGAGGG + Intergenic
1163719834 19:18893824-18893846 GGAGGGCTCTGGGGGCCAGAAGG + Intronic
1163765344 19:19160632-19160654 GGGTGGGGGTGAGGGCCCGCGGG + Intronic
1163871993 19:19829957-19829979 TGATGGGGATGGGGCCAAGATGG + Intergenic
1163886290 19:19967457-19967479 TGGTGGGGGTGGGGCCAAGATGG - Intergenic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1165063288 19:33215442-33215464 GGCAGGGGGTGGGGTTCAGAGGG + Intronic
1165080350 19:33302894-33302916 GGGTAGGGGTGGGGGGCGGAGGG + Intergenic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165109560 19:33493812-33493834 GCTGTGGGGTGGGGGCCAGAGGG - Intronic
1165129636 19:33623488-33623510 GGAGAGGGGCGGGGGACAGAGGG + Intronic
1165160615 19:33813567-33813589 GGAGAGTGGTGGGGGCCTGAGGG + Exonic
1165256445 19:34579463-34579485 GGATGGAGGGAGGGGGCAGAGGG + Intergenic
1165311457 19:35031177-35031199 GGAGGGGGGTGGGGGGAAGGCGG + Intronic
1165354534 19:35295538-35295560 GGTTGGGGATGGGAGCCGGAGGG + Intronic
1165682755 19:37791471-37791493 GGATGAAGATGGGGGGCAGAGGG + Intronic
1165741591 19:38207988-38208010 GGGTGGGGGTGGGGGACGGGTGG - Exonic
1165782249 19:38441448-38441470 TGATGGGGGTGGGGGCTTGAGGG + Intronic
1165792450 19:38500304-38500326 GGATGGGGATGGGGAACACAGGG + Intronic
1165802372 19:38560943-38560965 GGGTGGGGATGGGGACGAGAGGG + Intronic
1166102058 19:40576863-40576885 GGAAGTGGGTGCGGGCCAGCCGG + Exonic
1166105925 19:40598098-40598120 GGGTGGGGGTGCTGGGCAGACGG - Intronic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1166294865 19:41883997-41884019 GGCTGGGGGTGGGAGACGGAGGG + Intronic
1166297713 19:41897087-41897109 GGCGGGGGGTGGGGGGCAGGGGG - Intronic
1166359854 19:42248575-42248597 GGATGAGGGTGAGGACAAGAAGG - Exonic
1166583123 19:43920532-43920554 GGGTGGGGGGGGGGGGCAGTGGG + Intronic
1166671642 19:44713561-44713583 GGATGGGGGTGGGGTGAAGGTGG - Intergenic
1166856765 19:45786112-45786134 GGGTGCGGGTGCGGGCCAGGGGG + Exonic
1166878883 19:45914729-45914751 GGCTGGGGCTGGGGGCCCGTGGG + Exonic
1166888501 19:45975416-45975438 GGATGGGGGAGGGTAGCAGATGG + Intergenic
1166944693 19:46389843-46389865 GGATGGGGATGGGGAAAAGAGGG - Intronic
1166975697 19:46603945-46603967 GGCTGGGGGTGGGGGCGAGGAGG - Intronic
1166988651 19:46677747-46677769 GGATGGGAGTGGGGAGGAGAAGG - Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167114378 19:47480248-47480270 GGGTGGGGTTGAGGGCTAGAGGG - Intronic
1167198162 19:48044961-48044983 GGAGGGGGCTGGGGGCCATCTGG + Intergenic
1167198675 19:48048852-48048874 TGTTGGAGGTGGGGCCCAGAGGG + Intronic
1167281795 19:48573512-48573534 GCATGTGGGTGGGGGACAGGGGG + Intronic
1167342325 19:48923061-48923083 GGAAGGGGCTGGGGGCCAAGAGG - Exonic
1167456762 19:49600325-49600347 GGATGGGGGTGGGCGGTGGAAGG + Intronic
1167558417 19:50210327-50210349 GAAAGAGGGTGGGGGTCAGATGG - Intronic
1167618496 19:50548872-50548894 GGCTGTGGGTGGGGGAGAGAAGG + Exonic
1167640365 19:50678416-50678438 GGCAGGTGGTGGGGGCCAGAGGG + Intronic
1167690078 19:50979961-50979983 GGATGGGGGCGAGGACCAGAAGG + Intronic
1167692860 19:50997664-50997686 GGATGGGGGTGGGGGTGGTAAGG - Intronic
1167902595 19:52633197-52633219 GGGCAGGGGTGGGGGCCACAAGG - Intronic
1167903252 19:52637850-52637872 GGAGGGAGGTGGGGGGGAGACGG + Intronic
1168241686 19:55092045-55092067 GGATGGGGCTGTGGGCCTGCCGG - Intronic
1168295164 19:55374592-55374614 GGCCGGGGGTGAGGGTCAGAGGG - Intergenic
1168315342 19:55482506-55482528 GGACGGGGGTGGCGGCGGGACGG - Exonic
1168409814 19:56132650-56132672 GGCTGGAAGTGGGGGCGAGACGG + Intronic
925007086 2:451938-451960 GGATGGGGGTGGTGGGGGGATGG + Intergenic
925157659 2:1659994-1660016 GGAGTGGGGTGATGGCCAGAGGG + Intronic
925436458 2:3842434-3842456 GGAAGGGGGTGGTGGGCAGAGGG + Intronic
925462389 2:4074698-4074720 GGCAGGGGTTGGGGGCGAGATGG - Intergenic
925607558 2:5673800-5673822 GGCCGGGGGTGGGGGACAGAGGG + Intergenic
925848082 2:8051871-8051893 GGATGCGGGTGGCGGTGAGAAGG + Intergenic
926120251 2:10237841-10237863 GGCTGGGGGTGGAGGCAGGATGG - Intergenic
926149197 2:10415357-10415379 GGATGGGGGTGCGGGGCACCTGG - Intronic
926166371 2:10523982-10524004 GGGTGGTGTGGGGGGCCAGACGG + Intergenic
926426257 2:12740979-12741001 GGATGGGGATTGGGGTGAGATGG + Exonic
926766982 2:16330530-16330552 GGAGGTGGGTGGGGGCCAGGGGG - Intergenic
926890817 2:17637531-17637553 GGGTGGGGTTGGGGGCTGGATGG - Intronic
927492969 2:23532693-23532715 GCATGGGGGTGGGTGTCAGGTGG + Intronic
927557940 2:24049417-24049439 TGTGGGGGGTGGGGGGCAGAAGG - Intronic
927564980 2:24104254-24104276 GGGTGGGTGTGGGGCCCAGTGGG - Intronic
928098815 2:28423006-28423028 GGGTGGGGGTGGGGGCCCTAAGG - Intergenic
928907235 2:36381098-36381120 GGGTAGGGGCGGGGGCAAGAAGG - Intronic
929124666 2:38512386-38512408 GGCTGGGGGTGGGGCCCAGCGGG - Intergenic
929147622 2:38720440-38720462 GGCTGTGGGTGGGGGCAAGGAGG + Intronic
929242346 2:39665854-39665876 GGAGGGAGGTGGGGGGCAGGTGG + Intronic
929532035 2:42758928-42758950 GGATGGGGGTGGGGGCAGAATGG - Intergenic
929732733 2:44513215-44513237 GGGTGGGGGTGGGTGCAGGAAGG - Intronic
929775707 2:44929465-44929487 GGTTTGGGGTGGGGGCCGCAGGG + Intergenic
929895864 2:45960454-45960476 GGAGTGGTGTGGGGGGCAGAAGG + Intronic
929983116 2:46699239-46699261 GGAAGGGGGTGGGGGCCTGGCGG + Intronic
930003400 2:46877268-46877290 AGACGGGAGTTGGGGCCAGATGG - Intergenic
931036721 2:58252024-58252046 GGATGGGGTTGGGGGCCTCTCGG - Intergenic
931237412 2:60423206-60423228 GGGTGGGGGAGGTGGCTAGAGGG - Intergenic
931422461 2:62141016-62141038 GGATGCAGGTGGGGGAGAGATGG + Intronic
931551806 2:63454349-63454371 GTTTGGGGGTGGGGGACTGAGGG + Intronic
931592155 2:63896345-63896367 GTATGGGGGTGGGAGGGAGAAGG + Intronic
931613119 2:64125262-64125284 GGATGGGGCTGGTCGCCAGAAGG - Intronic
931881703 2:66576371-66576393 AGATGGGGGTGAGGGCAGGAGGG - Intergenic
931949399 2:67345563-67345585 TGGTGGGGGTGGGGACCAGGAGG - Intergenic
932343739 2:70982462-70982484 GGATGAGGGGAGTGGCCAGAGGG - Intronic
932398977 2:71466617-71466639 GGATCTGGGTAGGGGCCGGAGGG + Intronic
932422803 2:71611533-71611555 GGTAGAGTGTGGGGGCCAGACGG + Exonic
932495921 2:72145695-72145717 GGCGGGGGGTGGGGGCGAGGCGG - Intronic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
933158382 2:78998588-78998610 TGATGGGGGTAGGAGCAAGATGG - Intergenic
933278664 2:80308568-80308590 GGCTGAGGGTGGGGGCCCCAAGG + Intronic
933317630 2:80734704-80734726 GGATGGGGGTTGGGGGGAGAAGG + Intergenic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933689979 2:85172306-85172328 GTGTGGGGGTGGTGGCCACAGGG - Intronic
933732905 2:85471143-85471165 GGATGGGGGTGGGAGGGAGGTGG + Intergenic
933773153 2:85756186-85756208 GGGTGGGGGTGGGGGACGGGTGG + Intronic
933899039 2:86836126-86836148 GGATGGGTGGGGGAGCCAGCAGG + Intronic
934521329 2:95021971-95021993 GGATGGGGATGGAGGGTAGAGGG - Intergenic
934663684 2:96156273-96156295 GGGTGGGGGTGGGGGACTGCTGG - Intergenic
935105331 2:100038294-100038316 GAATGGGGTTGGGGTCCAGGTGG - Intronic
935315026 2:101824118-101824140 GGGTGGGGGCGGGGGAAAGAGGG + Intronic
935487712 2:103678269-103678291 GGATAGGGATGGGAGCCAGTTGG - Intergenic
935632350 2:105222633-105222655 GGGCTGGGGTGGGGGCCGGAGGG - Intergenic
935963465 2:108449334-108449356 GGATGTGGGAGTGGGCCCGATGG + Intronic
936024146 2:109018464-109018486 GGAGGATGGTGGGGGACAGAAGG - Intergenic
936073141 2:109384496-109384518 GGAGAGGGGTTGGGGTCAGAGGG + Intronic
936233023 2:110720583-110720605 GGGTGGGGGTGGGTGGCAGATGG - Intergenic
936410544 2:112254635-112254657 GGAGCGGGGTGGAGGCGAGAAGG - Intronic
937050164 2:118882078-118882100 GGATTGGGGAGGTGGGCAGATGG + Intergenic
937207570 2:120246293-120246315 GGATGGGCTTGGGAGACAGAGGG + Intronic
937341549 2:121094449-121094471 GGGTTGGGGTGGGGGGCACAAGG + Intergenic
937377535 2:121347933-121347955 GGTGGGGGGTGGGGGAGAGAGGG - Intronic
937899908 2:127012028-127012050 GGTGGGGGGTGGGGGCTAGGAGG - Intergenic
938639967 2:133267284-133267306 GGCTGGGGGTGGGGGCGTGAAGG - Intronic
938777050 2:134551068-134551090 GGCTGGGGGTGGGGGTCACCAGG + Intronic
939052002 2:137318515-137318537 GGATGGGGGCGGGGGAGTGAGGG - Intronic
939476027 2:142687180-142687202 GGAAGGGGGGAGGGGACAGATGG + Intergenic
939700622 2:145386640-145386662 GGATGGGGGCGGGGGCAGGGGGG - Intergenic
940273554 2:151916188-151916210 GAATAGGGGTGGGGCCAAGATGG - Intronic
940646045 2:156393991-156394013 GGAAGGGGGTGGGGGCGCGAGGG + Intergenic
940751112 2:157628485-157628507 GCACGGGGGTGGGGGACAGGGGG - Intronic
940855916 2:158728626-158728648 GGAGAGGGGTGGGGGCCACAGGG + Intergenic
941062584 2:160864780-160864802 AGATGGATGTGGGGTCCAGAAGG + Intergenic
941111540 2:161423291-161423313 GGGTGGGGGTGGGGGCAGAAGGG - Intronic
941379422 2:164775220-164775242 GGTTGGGGGTGGTAGCCAGATGG - Intronic
941702849 2:168623246-168623268 GGATAGGAGTGGGGGAAAGAGGG + Intronic
942080056 2:172391760-172391782 GGGTGGGGGTTGGGTCTAGATGG + Intergenic
942135985 2:172925955-172925977 GGAGGGGGAGGGGGGACAGAGGG + Intronic
942136596 2:172931975-172931997 GGGTGGGGGTGGGGGGCGCATGG - Intronic
942277890 2:174336072-174336094 GGATGGGGGAGGGAGCAAGAAGG - Intronic
942425118 2:175851987-175852009 GGGTGAGGGTGGGGGTCGGAGGG + Intergenic
942947195 2:181683821-181683843 GGATGGGGGTGGGGAAGGGATGG + Intergenic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943185126 2:184598195-184598217 GCGTGGGGGTGGGGGCGAGGGGG - Intergenic
944524461 2:200604261-200604283 GAATGGGGGTGGGGTCCCCATGG + Intronic
944665212 2:201953984-201954006 GGGTTGGGGTGGGAGCCAGATGG - Intergenic
944680546 2:202073125-202073147 GGATGGGGGTGGGGGTCAAATGG - Intergenic
945098017 2:206237972-206237994 GGATGAGGGTATGGGGCAGAAGG + Intergenic
945175740 2:207041520-207041542 GGATGGGGGAGGGGGCATGAAGG - Intergenic
945175785 2:207041752-207041774 GGGTGGGGGTGGGGGCTGGGGGG - Intergenic
946160233 2:217831414-217831436 AGATGGGGAGGGGGGCCAGGGGG - Intronic
946311749 2:218885772-218885794 GGATTGGGGTGGTGCTCAGATGG + Intronic
946396803 2:219447523-219447545 GCAGGGGTGTGGGGGCCAGCTGG + Intronic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
946411871 2:219519431-219519453 AGAGGAGGGTGTGGGCCAGAGGG - Intronic
947388835 2:229619511-229619533 GGATGGAGTTGGGGGTGAGACGG + Intronic
947524122 2:230868217-230868239 GGATGGGGGTGGGGGCCAGCTGG + Intronic
947527422 2:230886983-230887005 GGGTGGGGGTGGGAGGCAGGGGG + Intergenic
947629796 2:231644748-231644770 GGTTGGGGGTGGGGGCGGCAGGG - Intergenic
947787717 2:232838803-232838825 GGGTGGGGGAGGGGTGCAGAGGG - Intronic
947819133 2:233058687-233058709 GGATGTTGGTGGAGGCCAGCAGG + Intergenic
947911068 2:233801316-233801338 GGGTGGGGGTGGGGTGGAGAGGG + Intronic
948048525 2:234961880-234961902 GGGTGGGGGTGGGGGTGAGGAGG + Intronic
948099958 2:235365596-235365618 GGAAGGGGGTCTGGGCCAGAAGG + Intergenic
948179200 2:235966353-235966375 GGATGGAGGAGAGGGCGAGAAGG + Intronic
948355717 2:237375334-237375356 GGATGGAGGATGGGGCCAGGAGG + Intronic
948805966 2:240453532-240453554 GGGTGGGGGAGGGGGCTCGAAGG - Intronic
948861347 2:240754172-240754194 TGCTGGGGGTGGGGCCCCGAGGG + Intronic
948918344 2:241049796-241049818 GGCTGGGGGCGGGGGACAGAGGG - Exonic
949049060 2:241887516-241887538 GGGTGGGGGTGAGGGGCAAATGG - Intergenic
1168773129 20:428702-428724 GGATGGGAGTGACAGCCAGAAGG - Intronic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1169132449 20:3173251-3173273 GGGGGGAGGTGGCGGCCAGAGGG - Intronic
1169191889 20:3663136-3663158 GGATGGCGGTGGTGGCTTGACGG + Intronic
1169342173 20:4804902-4804924 GGATGAGGGTGGGGTCCTGGGGG + Intronic
1169594129 20:7178615-7178637 GGTTGTGGGTGGGGGCCAAGAGG - Intergenic
1170474405 20:16700805-16700827 GGAAGGGGTTGGGGGCCTGGAGG - Intergenic
1170696660 20:18665216-18665238 AGTTGGGGCTGGGGGCCAGGGGG + Intronic
1170740632 20:19053048-19053070 GGATGGCTGTGGGGACCAAAGGG - Intergenic
1170759295 20:19235663-19235685 GGAAGGGGTTGGGGTCTAGAGGG - Intronic
1171291823 20:23986720-23986742 GGAAGGTTGTGGGTGCCAGAGGG - Intronic
1171320784 20:24242318-24242340 GGATGGGGCTGGGGTCCTGAGGG - Intergenic
1171364752 20:24616323-24616345 GGAAGGAGGTGCCGGCCAGATGG - Intronic
1171450809 20:25234861-25234883 TGATGGGGGTGTGAGCCACATGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172240630 20:33410330-33410352 GTCTGGGGGTTGGGGGCAGAGGG + Exonic
1172526453 20:35602826-35602848 GGTTGGGGGTGGGGGAAGGAGGG - Intergenic
1172656264 20:36540782-36540804 GGATGGGGGCGGGAGCCGGAGGG - Intergenic
1172728933 20:37069763-37069785 GGATGGGGGTGCTGGCCTGGCGG - Intronic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1172805817 20:37610909-37610931 GGGTGGGGTTTGGGGCAAGATGG - Intergenic
1172846934 20:37935219-37935241 GGCTGGGGGTGGGGGGCTGGGGG - Intronic
1173077087 20:39829430-39829452 GGGTCGTGGTGGGAGCCAGAGGG + Intergenic
1173166398 20:40689585-40689607 GGATGGGGGTGGGGTGCAAAGGG - Intergenic
1173581973 20:44153537-44153559 AGATGGAGGTGGGGGGCTGAGGG + Intronic
1173590150 20:44218615-44218637 GGAAGTGGTTGGGGGCCAGCAGG + Intergenic
1173684119 20:44910586-44910608 GGGTGGGGGTGGGGGTCAGGCGG + Intronic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173785699 20:45791657-45791679 GGCTGGGGTTGGGGAGCAGAGGG - Intronic
1173846404 20:46191423-46191445 GGATGGGGATGGGGGCCAATGGG + Intronic
1174438955 20:50533438-50533460 GGCTGGGGGCGGGGGGCAGGGGG - Intronic
1174553310 20:51376705-51376727 GCATGGGGGAGGGGACGAGAGGG - Intergenic
1175124767 20:56742907-56742929 GGATGGGGGTAAGGGCATGAAGG + Intergenic
1175153133 20:56950981-56951003 GGAGGGGGATGGGGGAGAGAAGG + Intergenic
1175239145 20:57533881-57533903 GGATCAGGGTGGGGGCCAGGAGG - Intergenic
1175265875 20:57703249-57703271 TGATGGGGGTGGGGGACATCAGG + Intronic
1175350653 20:58315685-58315707 GGCTGGGGGTGGGGTGAAGAGGG - Intronic
1175470740 20:59225706-59225728 GGAGGGTGGTGGGGGCCAGCAGG + Intronic
1175729866 20:61346902-61346924 GGATGGGGATGAGGGACAGATGG - Intronic
1175831113 20:61965910-61965932 GGGTCGGGGTCGGGGCTAGAGGG - Intronic
1175838030 20:62008699-62008721 GGAGTGGGGAGAGGGCCAGAAGG + Intronic
1175855761 20:62120086-62120108 GGGTGGGGTGGGGGGACAGAAGG + Intergenic
1175911752 20:62408382-62408404 GGAGGTGGGTAGGGGCCTGAAGG - Intergenic
1175914636 20:62419934-62419956 GTATGTGGCCGGGGGCCAGAGGG + Intronic
1175967451 20:62666568-62666590 GGCGGGAGGTGAGGGCCAGATGG + Exonic
1175995267 20:62809501-62809523 GGGTGTGGGTGGGGGACATAAGG - Intronic
1176129539 20:63490850-63490872 GCCTGGGGGTTGGGGCCACATGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176359554 21:5983291-5983313 GGGTGGAGGTGGGAGCCACAGGG - Intergenic
1176621520 21:9064950-9064972 GGAGGGGAGTGGGGGTCTGAAGG + Intergenic
1176713701 21:10331030-10331052 GGATGGGGTTGGGGGCCTCTCGG - Intergenic
1176721513 21:10397529-10397551 GGAGGTGGGTGGGAGCCAGCAGG + Intergenic
1177782907 21:25639561-25639583 GTGTGGGGGTAGGGGCTAGAGGG - Exonic
1177995730 21:28094859-28094881 AGATGGGGGTGGGGGAGTGAGGG + Intergenic
1178479937 21:32971158-32971180 GGGTGGGGGTGGGGGGCGGGGGG - Intergenic
1178631885 21:34268547-34268569 GGATGGTGGTGTGGGCTGGAGGG + Intergenic
1178974411 21:37209013-37209035 GGATGGGGGTGGGGGCTGGGGGG + Intergenic
1179171331 21:38975258-38975280 GGATGGGATTGGGAGCCACATGG - Intergenic
1179409880 21:41154237-41154259 GGATGGGAGCTGGGGCCAGGTGG + Intergenic
1179568607 21:42264732-42264754 GGAAGGAGGTGGGGGAGAGATGG + Intronic
1179591489 21:42412215-42412237 GGATGGGGGTGGGAGCCCCGTGG + Intronic
1179712017 21:43268914-43268936 GGATGTGGGTGGGGGTCAGTTGG - Intergenic
1179763964 21:43555259-43555281 GGGTGGAGGTGGGAGCCACAGGG + Intronic
1180093146 21:45542687-45542709 CGGCGGGGGTGGGGGCCCGAGGG - Intronic
1180190818 21:46161723-46161745 GGATGGGGGTGGGGGGCTCGGGG + Intronic
1180230926 21:46426442-46426464 GGAGGTGTGTGGGGGGCAGAAGG + Intronic
1180302706 22:11050304-11050326 GGAGGTGGGTGGGAGCCAGGAGG + Intergenic
1180765578 22:18344386-18344408 GGAAGGTTGTGGGTGCCAGAGGG + Intergenic
1180780738 22:18518006-18518028 GGAAGGTTGTGGGTGCCAGAGGG - Intronic
1180813451 22:18775313-18775335 GGAAGGTTGTGGGTGCCAGAGGG - Intergenic
1180835257 22:18926509-18926531 GAATGGGGGTGCTGGCCAGGCGG - Intronic
1180844289 22:18972992-18973014 GGATGGGGTGAGGGGCCAGCTGG - Intergenic
1180906131 22:19413254-19413276 AAATGGGGGTGGGGGCCTCAAGG + Intronic
1181057183 22:20265719-20265741 GGATGGGGTGAGGGGCCAGCTGG + Intronic
1181063268 22:20292044-20292066 GGGTGGGGGTTGGGGGCAGTAGG + Intergenic
1181085446 22:20437545-20437567 GGCTGGGGGAGGGGGCGAGAGGG - Intronic
1181133670 22:20749587-20749609 GGATGTGGGAGGCTGCCAGATGG - Intronic
1181199633 22:21209643-21209665 GGAAGGTTGTGGGTGCCAGAGGG - Intronic
1181387703 22:22557877-22557899 GGCTGGGGGTGGGGAGGAGATGG + Intronic
1181400126 22:22646215-22646237 GGAAGGTTGTGGGTGCCAGAGGG + Intronic
1181551423 22:23641062-23641084 GGATGGGGGTGAGAGCCTGGGGG - Intergenic
1181613517 22:24035884-24035906 GGCGGGGGGTGGGGGGCCGAGGG - Intronic
1181631056 22:24151584-24151606 AGGTGGGGGTGGGGCTCAGAGGG + Intronic
1181649238 22:24249575-24249597 GGAAGGTTGTGGGTGCCAGAGGG - Intergenic
1181675805 22:24450902-24450924 GAAGGTGGGTGGTGGCCAGAGGG + Intergenic
1181702099 22:24627313-24627335 GGAAGGTTGTGGGTGCCAGAGGG + Intronic
1181813835 22:25421625-25421647 GGCTGGGGGAGGGGGCGACAGGG - Intergenic
1181854479 22:25772272-25772294 GGTGGGGGCAGGGGGCCAGAAGG + Intronic
1181969402 22:26678814-26678836 GGATGGGGGACAGGGACAGAAGG + Intergenic
1181997162 22:26892056-26892078 GGGTGGGGGTGGGGGCAGGTAGG + Intergenic
1182023017 22:27097071-27097093 GAATGAGTGTGGGGGCCAGGTGG + Intergenic
1182054276 22:27337764-27337786 GAATGGGTGTGGGGGCAACAAGG + Intergenic
1182071570 22:27467229-27467251 GGGTTGGGGTGGTGGCCAGCGGG + Intergenic
1182096706 22:27630660-27630682 GGGTGGGGGGTGGGGGCAGAGGG - Intergenic
1182109838 22:27715311-27715333 GCAGGCGGGTGGGGGACAGAAGG - Intergenic
1182130232 22:27845213-27845235 GGATGGGGGGGTGGGCAGGAGGG - Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182422400 22:30254772-30254794 GGGTGGGGGTGGGGGACTTAGGG + Intergenic
1182551945 22:31105303-31105325 GGAGCGGGGTGGTGGGCAGAGGG + Intronic
1182845968 22:33431134-33431156 GGATGGAGGAGGGAGGCAGAAGG + Intronic
1183018074 22:35006295-35006317 GGGTGGGGGTGGGGGTCTGAGGG + Intergenic
1183113223 22:35668629-35668651 GGATGGAGATGGGGGGCAGGAGG - Intergenic
1183298655 22:37047107-37047129 AGATGGGGGTGGGAACAAGATGG + Intergenic
1183303754 22:37071045-37071067 GGATGGGGGCAGGGCACAGAAGG + Intronic
1183306527 22:37085908-37085930 GGGAGGGGGTGAGGGGCAGAGGG + Intronic
1183414672 22:37675531-37675553 GGATAGGGCTGGGGGCCACTGGG - Intergenic
1183427096 22:37745997-37746019 GGAGGGCGGTGGCGGCCGGAGGG - Intronic
1183536003 22:38401790-38401812 GGCTGGGAGAGGGGCCCAGAGGG + Intergenic
1183543162 22:38441437-38441459 GGCTGGGGGTGGGGGTGAGGTGG + Intronic
1183731147 22:39619262-39619284 GGATGGTGCTGGAGGCCAGCTGG - Intronic
1183767824 22:39895425-39895447 GTAATGGGGTGGGAGCCAGAGGG + Intergenic
1184038086 22:41927992-41928014 AGATGGGGGTGAAGGCCAAAGGG + Intergenic
1184150744 22:42636957-42636979 GGATGAGGGTGGTGGGGAGAGGG - Intronic
1184158817 22:42686126-42686148 GGATTGGGCTGGGGCCAAGAGGG + Intergenic
1184177058 22:42794464-42794486 GGAAGGGGGTGAGGGCCAGGAGG - Intergenic
1184240459 22:43208973-43208995 GGCTTGTGGTGGGGGACAGAAGG + Intronic
1184252347 22:43267966-43267988 GGATGGGCCTGGGCTCCAGATGG + Intronic
1184415167 22:44347989-44348011 GGATTAGAGTGGGGGCCAGGAGG - Intergenic
1184422530 22:44390304-44390326 GGATGGATGTGGGGGTGAGAGGG + Intergenic
1184474445 22:44712916-44712938 GGGAGGGGTTGGGGGTCAGAGGG + Intronic
1184485291 22:44774833-44774855 GGGTGGGGGCGGGGGGCGGATGG + Intronic
1184502703 22:44883371-44883393 GGAGGGGAGAGGGGCCCAGACGG - Intronic
1184605892 22:45574661-45574683 GGATGGGTGTGGGGGTCCCAGGG + Intronic
1184799925 22:46753031-46753053 GGATGGGGGTGGGGGAGGCATGG - Intergenic
1184822377 22:46918925-46918947 GGGAGTGGGTGGGGGACAGAAGG - Intronic
1185168424 22:49276663-49276685 GGATGGGGGTGGTCCCGAGACGG - Intergenic
1185212821 22:49581419-49581441 GGATTGGCATGGGGGCAAGATGG + Intronic
1185226075 22:49653642-49653664 GGTTGGGGGCGGGGGCGGGAAGG - Intronic
1185297055 22:50059613-50059635 GGAATGGGGTGGGAGCCACAGGG - Exonic
1203227200 22_KI270731v1_random:85276-85298 GGAAGGTTGTGGGTGCCAGAGGG + Intergenic
1203263552 22_KI270734v1_random:995-1017 GGAAGGTTGTGGGTGCCAGAGGG - Intergenic
1203285345 22_KI270734v1_random:151808-151830 GAATGGGGGTGCTGGCCAGGCGG - Intergenic
949505092 3:4719905-4719927 GGCTGGGGCAGGGGGACAGATGG + Intronic
949807421 3:7970869-7970891 GGCTAGGAGTGGGGGACAGAAGG + Intergenic
949943160 3:9170405-9170427 GCAGCGGGGTGGGGGCAAGAGGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950185732 3:10944489-10944511 GGATGGTGGTGGAGGCCATGTGG + Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950221910 3:11202539-11202561 GGAGGAGGGTGGGGGCCAGGAGG - Intronic
950423863 3:12914332-12914354 GGATGGGGGAGGCGGTCAAAGGG + Intronic
950451894 3:13070095-13070117 GGGTGGGGGTGGGGGCCCGCCGG + Intronic
950465770 3:13153001-13153023 GGATGGGGGTAGGGAGGAGAGGG - Intergenic
950538362 3:13594841-13594863 GGCTTGGGGAAGGGGCCAGAGGG + Intronic
950566379 3:13772142-13772164 GGGTGGGGGCGGGGGCCAGAGGG + Intergenic
950574625 3:13824629-13824651 GCATGGGCCTGGGGGCCAGGAGG - Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950634260 3:14303846-14303868 GGGTGGGGGTGAGCGGCAGATGG + Intergenic
950675966 3:14554640-14554662 GGATGGGGGTGGGTGTCCGTGGG - Intergenic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951217528 3:20039878-20039900 GGAGGGGGGAGGTGGCCAGCAGG + Intergenic
951558506 3:23944839-23944861 GGGTGGGGGTGGGGGGCGCAAGG + Intronic
952384631 3:32831138-32831160 AGATGGGGGTGGGGGACCGTGGG + Intronic
952384956 3:32833851-32833873 GGATGGGGGTGGGGCATAGCAGG - Intronic
952726311 3:36589424-36589446 TGAGGGGGGTGGTGGACAGATGG + Intergenic
952899300 3:38098993-38099015 GGATGGGGCTGGGGGCAGGGTGG + Intronic
952969285 3:38640836-38640858 GGCTGGGGGCGGGGGCCTCAGGG + Intronic
953259474 3:41323657-41323679 GGAGGGGGGTCGGGGGCAGAAGG - Intronic
953496781 3:43394209-43394231 GCCTGGGGGTAGGGACCAGAGGG - Intronic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
953571944 3:44078197-44078219 GGAAGGGGGTGGGGGTGAGCTGG - Intergenic
953682772 3:45052060-45052082 AGATGGGAGTGGGGGAGAGAAGG - Intergenic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
954146838 3:48638753-48638775 TGCTGGGGGTGGGGACCAGAGGG - Intronic
954147380 3:48641022-48641044 GGATCTGGGTGGGGGGCAGGGGG + Intronic
954156310 3:48686578-48686600 TGATGGGGGTGGGAGCTTGACGG - Intergenic
954196272 3:48998969-48998991 GGCTGGGGGTTGGGGGCAGGCGG - Intronic
954217694 3:49133530-49133552 GAATGGGGCTGGGGGAGAGATGG + Intergenic
954368252 3:50157212-50157234 GGATGGGACAGGGGGCCAGGTGG - Intronic
954392529 3:50275065-50275087 GGATGGGGGTCGGGGTGGGATGG + Intronic
954430469 3:50468144-50468166 AGATGGGGCTTGGGGACAGAGGG - Intronic
954743764 3:52775044-52775066 GGAAGGGGGTTGGGACCAGCTGG - Intergenic
954976415 3:54699301-54699323 GGAAGGGGCTGGAGGTCAGAGGG + Intronic
955203712 3:56876212-56876234 GGAGGTGGGCAGGGGCCAGACGG + Intronic
956079594 3:65543752-65543774 GGATGGGGGGGGGTACAAGAGGG + Intronic
956698222 3:71936558-71936580 GGAAGGGGTTGGAGGCTAGAAGG + Intergenic
957989333 3:87610058-87610080 TGATGAAGGTGGGTGCCAGAGGG + Intergenic
959491808 3:106999109-106999131 GGATGCGGGTGGGGCCAATAAGG + Intergenic
960228507 3:115195990-115196012 GGGCGGGGGGGGGGGCCAGGGGG + Intergenic
960987978 3:123292710-123292732 GGCTGGGGGTGGGGGGTAGGGGG + Intronic
961144847 3:124585015-124585037 GGATGGGGCTGGGGATCAGGAGG + Intronic
961397873 3:126609689-126609711 GGATCTGGGCGGGAGCCAGAAGG + Intronic
961657220 3:128449835-128449857 GGATGGGAGTGGGGGGCCGAGGG - Intergenic
961714955 3:128851834-128851856 GGATGGAGGGGGAGGCCACAGGG + Intergenic
962154856 3:132935332-132935354 GGATGGGGTTGGGGGTGGGATGG - Intergenic
962201268 3:133403089-133403111 GGAAAGGGGTGGGGGCCTGGTGG - Intronic
962657378 3:137561592-137561614 GGTTGGGGGTGGGGGCGGTAAGG + Intergenic
962743612 3:138381530-138381552 GGGCGGGGCTGGGAGCCAGAGGG - Intronic
962924356 3:139977702-139977724 GGGAGGGGGTGGGGGGCAGTGGG + Intronic
962947557 3:140185667-140185689 GGATGGGGGTGCAGGGCAGATGG + Intronic
963755885 3:149234853-149234875 GTATGGGGGAGGGGCCAAGATGG + Intergenic
963848813 3:150186817-150186839 GGATGGGGGGGTGGGGCAAATGG + Intergenic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
964643238 3:158931812-158931834 GGGTGGGGGTGGGGGCATGCAGG + Intergenic
965171117 3:165265681-165265703 GGAGGGGGGAGGGGGGAAGAAGG - Intergenic
965895417 3:173570085-173570107 TCTTGGGAGTGGGGGCCAGAAGG + Intronic
966331479 3:178819502-178819524 GGATGGGGGTGGGGGGAACAGGG - Intronic
966744935 3:183266515-183266537 GTATGGTGGAGGAGGCCAGAGGG + Intronic
966889774 3:184398557-184398579 GGGTGGGGGGGGGTGTCAGAAGG - Intronic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967390093 3:188947110-188947132 GGGTGGGGGTGGGGACTGGAGGG + Intergenic
968454091 4:688536-688558 TGAAGGGGGTGGGGGCAGGACGG + Intronic
968712200 4:2127134-2127156 GGAGGGGTGAGGGGGCCATAGGG + Intronic
968756234 4:2417835-2417857 CAATGGGGGTGGGGGCAGGACGG + Intronic
968758309 4:2428023-2428045 GGAAAGAGCTGGGGGCCAGAGGG - Intronic
968841044 4:3006020-3006042 GGAGGGGGCTGAGGGACAGAGGG - Intronic
969242086 4:5905914-5905936 GCAGGGGGGCGGGGGGCAGAGGG + Intronic
969308602 4:6339528-6339550 CGATGGGGGTGGGGCACAGCAGG - Intronic
969413969 4:7046886-7046908 GGCTGGGGGATGGGGCCTGAAGG + Intronic
969630829 4:8335004-8335026 GGAGGGTGGTGGGTTCCAGAAGG - Intergenic
969713263 4:8856578-8856600 GGATGCGGGTGGTGGCTACACGG + Intronic
970654831 4:18219455-18219477 TGTTGGGGGTGGGGGCCAGGGGG - Intergenic
971044616 4:22791490-22791512 GGATGGGGTTAGGGGCAAGGTGG - Intergenic
971304212 4:25466008-25466030 AGATGGCAGTGGGGGCCAGGTGG + Intergenic
971365901 4:25976976-25976998 TGAAGGAGGTGGGGGCCAGGTGG - Intergenic
971389429 4:26172246-26172268 GCAGGGTGGTGGGGGCCAGGCGG - Intronic
971406209 4:26322095-26322117 GGAGGGGGGCGGGGGCCGGGGGG - Intronic
972090039 4:35269995-35270017 GGTGTGGGGTGGGGGGCAGAAGG - Intergenic
972115572 4:35628973-35628995 TGATGGGGGAGGAGGCCACATGG + Intergenic
972195070 4:36644665-36644687 AGATGTGTGTGGGAGCCAGAAGG - Intergenic
972739602 4:41877812-41877834 GGGTGGGAGTGGGGGCCAAAAGG - Intergenic
972847813 4:43010590-43010612 GGATGGGGGTGGGGTGGGGATGG + Intronic
972909423 4:43796830-43796852 GGGTGGGGGTGGGGGCAGGGTGG - Intergenic
974036436 4:56821894-56821916 GGACGGGGGAGGGGGCCATGGGG + Intergenic
974709964 4:65578198-65578220 GGATGGGGGTGGAGTACAGTTGG - Intronic
975690544 4:76958365-76958387 GGCTGAGGCTGGGGCCCAGAGGG - Intronic
975719439 4:77235725-77235747 GGAAGGGGGTGAGGGATAGAAGG - Intronic
975927912 4:79481835-79481857 TGATGGGGGAGGGGGAAAGAAGG - Intergenic
975983310 4:80183176-80183198 GGATGGGGGAGGGGGGAGGATGG - Intergenic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976774996 4:88698130-88698152 GGATGGGGGTGAGGAGCACACGG - Exonic
976775419 4:88700697-88700719 CGAGGGGGGTGGGGGCAAGGAGG + Intronic
978617670 4:110612603-110612625 GGATGGAGGTGGGGAGCCGAAGG - Intergenic
978638234 4:110837569-110837591 GGGTGGGGGTGGGGACCAGAAGG + Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
980869876 4:138598861-138598883 AGAAGGGAGTGGGGGCCAGCTGG - Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981655241 4:147105258-147105280 GGATGGTGGAGGGGGCAGGATGG - Intergenic
981920504 4:150079589-150079611 GGCTGGGGGTGGGGGCCGGTGGG + Intronic
982017448 4:151168937-151168959 GGATGGGGGTAGGGGCAGGCAGG + Intronic
982181353 4:152751329-152751351 GGTTGGGGGTGGGCTTCAGAGGG - Intronic
982312519 4:154000845-154000867 GGGTGGGGGGGGGGGCAAAATGG + Intergenic
982528102 4:156505317-156505339 GGGTGGGGGGTGGGGCAAGAGGG + Intergenic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983577089 4:169271237-169271259 GGATTGGGGCGGCGGCCTGAGGG + Intergenic
983907341 4:173197790-173197812 GGATGGGCTTTGGGACCAGAAGG + Intronic
984521024 4:180801111-180801133 GTATGGAGGTGGCGGCCAGGGGG - Intergenic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985512218 5:319175-319197 GAGTGTGGGTGGGAGCCAGAGGG + Intronic
985520697 5:372838-372860 TGCTCGTGGTGGGGGCCAGATGG + Intronic
985700815 5:1371288-1371310 TAAGGGGGGTGGGGGCCTGATGG - Intergenic
985783243 5:1881630-1881652 GGGTGGGGGTGGGGTTCTGAGGG + Intronic
985839959 5:2298696-2298718 GGATGGAGGTGGGGGTTGGAGGG + Intergenic
986004329 5:3655601-3655623 GGCTGGTGATGGGGGCAAGAGGG - Intergenic
986037853 5:3958445-3958467 TGAGGGCGATGGGGGCCAGAAGG - Intergenic
986603296 5:9495917-9495939 GGATGGGAGAGGGGAGCAGAGGG - Intronic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987197467 5:15541508-15541530 GAATAGGGGTGGGGGTAAGATGG - Intronic
987445999 5:18020676-18020698 GGGAGGGGGTGGGGGGCAGGCGG + Intergenic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988207070 5:28152318-28152340 GGATTGGGGTGTGGGGGAGATGG - Intergenic
988227535 5:28431422-28431444 GGGTGGGGGTGGGAGCGAGAAGG - Intergenic
988453050 5:31362367-31362389 GGATTGGGGTTGGGGGCCGAGGG + Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
988855116 5:35220829-35220851 GGAAGAGGCTGGGGGACAGAAGG - Intronic
988966605 5:36424939-36424961 GCCTGGGGATGGGGACCAGAGGG - Intergenic
989111854 5:37914155-37914177 GGAGTGGGGTGGGGGGCAGAGGG + Intergenic
990525814 5:56626361-56626383 TGATGGGGGAGGGTGGCAGAAGG - Intergenic
991029827 5:62071254-62071276 GGGTAGGGGTGGGGGCCAAGGGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
992091940 5:73325113-73325135 GAATGGGGGTGGGGGAGAAATGG - Intergenic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992225542 5:74616742-74616764 GGCTGGCGCTGGTGGCCAGAGGG - Intergenic
992314400 5:75537270-75537292 GCATGGGGGTGGGGGGCACAGGG + Intronic
992628524 5:78657866-78657888 GGGTGGGGGTGGGAGGTAGAGGG + Intronic
992707648 5:79413574-79413596 GGTAGGGGGTGGGGGCGTGAGGG - Intronic
993117376 5:83734400-83734422 GATTGGGGGTGGGGCCAAGATGG - Intergenic
993410015 5:87562506-87562528 GTCTGGGGGTGGGGGCCAAGGGG - Intergenic
993447868 5:88036896-88036918 AAAAGGGGGTGGGGGCAAGAAGG + Intergenic
993502395 5:88678488-88678510 GGATGGGGGTGAGGGCGGGGTGG - Intergenic
994051491 5:95367163-95367185 GGAAGGTGGTGGGGGACAGAAGG - Intergenic
994100115 5:95882593-95882615 GGGTGGGGGTGGGGGGCGGATGG + Intergenic
995188624 5:109297543-109297565 GGATGGGGGCGGGGGTGAGGGGG + Intergenic
995292534 5:110473969-110473991 GGCTGGGGGTGGGGGAGAGTAGG + Intronic
995483886 5:112619598-112619620 GGATGGCAGTGGGGGGCAGGAGG + Intergenic
996329244 5:122311665-122311687 GGAAGGGGGTGGGGGGCAGGAGG + Intronic
996412374 5:123172208-123172230 GGATGGAGGTGGCGGGGAGAGGG + Intronic
997287233 5:132688925-132688947 GGATGGGGGAGGGGAGCAGGTGG + Intergenic
997680780 5:135749344-135749366 GGCTGGGGGAGGGGGACAGTGGG - Intergenic
997824071 5:137090921-137090943 AGATGGGGGTGGGGAGGAGAGGG - Intronic
997941241 5:138159479-138159501 TAATGGGGGTGGGTGGCAGAGGG - Intronic
998093299 5:139383187-139383209 GGCTGGGGGTGGGGGCTAGGGGG - Intronic
998138844 5:139688746-139688768 GGCTGGGGGTGGGGGGCGGGGGG - Intergenic
998140580 5:139697499-139697521 GGAAGGAGGGGAGGGCCAGAAGG - Intergenic
998352207 5:141508968-141508990 GGCTGGGGGTGGGGGCCAGCTGG + Intronic
998365759 5:141629785-141629807 GGATGATGGTGGGGGGCAGCTGG - Intronic
998935055 5:147226321-147226343 GGGTGGAAGTGGGGGCCGGACGG - Intergenic
999127956 5:149260195-149260217 TGATGGGGTGAGGGGCCAGAGGG + Exonic
999209684 5:149877217-149877239 GAATGGGGGTGGGGTTCAGGGGG + Intronic
999231948 5:150066851-150066873 GGGTGGGGTTGGGGGTCTGAAGG - Intronic
999242660 5:150136723-150136745 GGCCAGGGGTGTGGGCCAGAAGG + Intronic
999300064 5:150485720-150485742 GGTAGGGGGCGGGGGCCGGAGGG - Intergenic
999431713 5:151530780-151530802 GGATGGATGTAGGGGCCAAAGGG + Intronic
999748455 5:154609345-154609367 GGTTGGGGTTGGGGGATAGAGGG + Intergenic
999814655 5:155163725-155163747 GGAAGGGGGTGGAGCCAAGATGG - Intergenic
999873247 5:155773885-155773907 GGATGTGGGTGGAGACCTGAGGG + Intergenic
1000182891 5:158829588-158829610 GGATGGGGATGGGGTTGAGAAGG + Intronic
1001397719 5:171428926-171428948 GGATGGGGGGTTGGGCCCGAGGG - Intronic
1001692130 5:173641153-173641175 TGGTGGGCGTGGGGGCTAGATGG + Intergenic
1002079763 5:176730387-176730409 GGATGGGGGTGGGGGACAGGGGG + Intergenic
1002220539 5:177676662-177676684 GGATGGGGGAGGTGGCAAAAGGG - Intergenic
1002301451 5:178259618-178259640 GGATGGGGATGGGGACGGGATGG - Intronic
1002306597 5:178287195-178287217 GGATGAGGGTGGGTCCCAGCTGG + Intronic
1002538927 5:179893529-179893551 GGATGGGTCTGGGGTACAGATGG - Intronic
1002543830 5:179925167-179925189 GGATGGGGCTGGTCACCAGAAGG + Intronic
1002562009 5:180088849-180088871 GGATGGGGCTGGTCACCAGAAGG - Intergenic
1002613699 5:180437315-180437337 TGATGGGGGTGGGGACAAGCTGG - Intergenic
1002992524 6:2250998-2251020 GGATGGGGGTGGGAGGGAGGTGG - Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003377449 6:5593017-5593039 GGAGGAGGGTGAGGGCCAGAGGG - Intronic
1003426608 6:6002205-6002227 GCCTGGGGGTTGGAGCCAGAAGG + Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003592222 6:7445892-7445914 GCATGGGGGTGGGTGGGAGAAGG + Intergenic
1003741864 6:8949719-8949741 GCATTGAAGTGGGGGCCAGATGG + Intergenic
1003964106 6:11236903-11236925 GGATGGGGGTCGGCGGTAGAGGG - Intronic
1005086812 6:22015387-22015409 GGATGGCGGTGGGGGTCAGGGGG - Intergenic
1005328346 6:24723691-24723713 GCATGGTGGTGGGGGCCTGTGGG - Intergenic
1005444811 6:25911213-25911235 GGATGGGGGTTGTGGCTGGATGG - Intergenic
1005544068 6:26845213-26845235 TGTTGGGGGTGGGGGCCTGGGGG + Intergenic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005601066 6:27426452-27426474 GGTTGTGGGTGGGGAGCAGATGG - Intergenic
1005916344 6:30355343-30355365 GGATGTGGGTCAGGGGCAGATGG + Intergenic
1005989040 6:30892008-30892030 GTATGGGGGTCTGGGCCAGCTGG + Exonic
1006155075 6:32009478-32009500 GGATGGGGATGGGGGCCCTGTGG - Intergenic
1006161386 6:32042213-32042235 GGATGGGGATGGGGGCCCTGTGG - Intronic
1006197519 6:32254981-32255003 GGATGGGGGTGGGGAGGCGAGGG + Intergenic
1006456862 6:34136941-34136963 GGGTTGGGGTGGGGGCCAGGCGG + Intronic
1006459787 6:34151698-34151720 GGGTGGGGGTGGGGGCGGGGTGG - Intronic
1006502379 6:34466770-34466792 GGAGGGGGGAGGAGGCAAGAAGG + Intronic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1006602589 6:35235795-35235817 AGAGGGGGGTGGGGAGCAGATGG - Intronic
1006789362 6:36689036-36689058 AGAGGGGGGTGGGGGCCTGGGGG + Intergenic
1006809567 6:36811145-36811167 GGCTGGGGGTGGGGACAAGGTGG - Intronic
1007194797 6:40051084-40051106 GGTGGGGGGTGGGGGCTAGGGGG + Intergenic
1007278515 6:40693088-40693110 GGCTGTGTGTGGGGGCGAGAGGG - Intergenic
1007371356 6:41428444-41428466 GGGTGGGGGTGTGGGGTAGAGGG - Intergenic
1007377531 6:41466980-41467002 GGATATGGGTGGGGGCCAGTGGG - Intergenic
1007397683 6:41586931-41586953 GCCGCGGGGTGGGGGCCAGATGG + Intronic
1007412511 6:41673286-41673308 GGAAAGGGGTGGGGGACAGAGGG - Intergenic
1007418605 6:41706259-41706281 GCAGGGAGGTGGGGGGCAGAAGG + Intronic
1007757758 6:44111425-44111447 GGATGGTGGTGGAGGGCAGTGGG - Intergenic
1007835993 6:44674176-44674198 GGCTGGGGGTGGGGAGAAGAAGG + Intergenic
1007841584 6:44720454-44720476 GGGTGGGGGTGAGGGGTAGATGG + Intergenic
1008026372 6:46640761-46640783 GGAGGGGGGTGGGCGGCAGGGGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008537762 6:52520209-52520231 GGCTGGGGGTGTGGAGCAGAAGG + Intronic
1008952597 6:57176673-57176695 GGATGGGGTTGGGGGTGATAGGG + Intronic
1010236619 6:73580152-73580174 GGATGGGGGTGGGGGTGGGTAGG - Intergenic
1010562106 6:77363124-77363146 GGGTGGGGGTGGGGGCAGGATGG + Intergenic
1011089686 6:83583183-83583205 GGATGTGGGTGGGGTGCAGCTGG - Intronic
1011756625 6:90505791-90505813 GGATGAGGGTGGAGGAGAGATGG + Intergenic
1011759416 6:90544962-90544984 TGATGGGGGTGGGGGAACGAAGG + Intronic
1012399785 6:98834181-98834203 GGATTGGGGTGGGGGGCGGGAGG - Intergenic
1012446239 6:99310016-99310038 GTATGGGTGAGCGGGCCAGATGG - Intronic
1013532142 6:111029865-111029887 GAATGGGGGTAGGGGTGAGATGG - Intergenic
1013608374 6:111771940-111771962 GGATGGGGGGCATGGCCAGAAGG + Intronic
1014043998 6:116862509-116862531 TGCTGGAGGTGGGGGCCTGATGG + Intergenic
1014550334 6:122782793-122782815 AGATGGAGGTGGGGAGCAGAGGG + Intronic
1015175319 6:130300965-130300987 GGTTGGAGGTGGGGGGCTGAGGG - Intronic
1015301326 6:131655841-131655863 GGGTGGTGGTGGTGGTCAGAAGG + Intronic
1015735659 6:136397496-136397518 TGGTGGGGGTGGGGGCAAGGTGG - Intronic
1015880366 6:137866023-137866045 AGATGGGGGTGGGGGCTGGATGG - Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016932903 6:149427316-149427338 GGATGGGGGTTGGGGAGAGTGGG + Intergenic
1017380713 6:153826044-153826066 TGGAGGGGGTGGGGGGCAGATGG - Intergenic
1017544049 6:155432406-155432428 GGCGGGGGGTGGGGGCAGGAAGG + Intronic
1017718186 6:157226711-157226733 GGCTGGGGGTGGGGGTGGGAGGG - Intergenic
1017920792 6:158870224-158870246 AGTTGTGGGTGGGGGACAGAAGG + Intronic
1018240310 6:161767757-161767779 GGCTGGGGGTGGGGGGCTGGGGG + Intronic
1019315074 7:380541-380563 GGAGGGGGCAGGGGGACAGAGGG + Intergenic
1019315088 7:380571-380593 GGAGGGGGCAGGGGGACAGAGGG + Intergenic
1019315103 7:380601-380623 GGAGGGGGCAGGGGGACAGAGGG + Intergenic
1019315118 7:380631-380653 GGAGGGGGCAGGGGGACAGAGGG + Intergenic
1019329493 7:455614-455636 GCGTGGGGGCGGGGGGCAGAGGG - Intergenic
1019405436 7:881323-881345 GGGTGGGAGTGGGGGCGAGGAGG - Intronic
1019442153 7:1052815-1052837 GCATGGGGTTGGGGGGCAGGCGG + Intronic
1019605259 7:1907023-1907045 GGATGGGGTTGGGGGCTTGGGGG - Intronic
1019701280 7:2476048-2476070 GGGTGGGGGTGGGGGTGGGAGGG - Intronic
1019735208 7:2647041-2647063 GGACGGAGGGCGGGGCCAGAGGG + Intronic
1019791534 7:3017191-3017213 GGATGGGCATGGCGGCCAGTGGG + Intronic
1019815507 7:3197091-3197113 GGACGGGGGTGGGGGCATGCTGG + Intergenic
1021162878 7:17298496-17298518 GGATGAGGGTGGGGCCCTCAAGG + Intergenic
1021510545 7:21428181-21428203 GGGTGGGGGTGGGGGCGAGGCGG - Exonic
1021537116 7:21718053-21718075 GGACGGGGGCGGGGGCAAGAGGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022230492 7:28408950-28408972 GGATGGGGGTAGGGGAGAGGTGG - Intronic
1022467290 7:30660529-30660551 GGATGGGGCTGGGTGCCAAGAGG - Intronic
1022501174 7:30883230-30883252 GGTTGGGGGTGGGGGCTAAATGG + Intronic
1022514458 7:30966399-30966421 GGGTGGGGGTGGGGGCCATGGGG + Intronic
1022517808 7:30987038-30987060 GGAGGGCGGGGGGAGCCAGAAGG + Intronic
1022781441 7:33588669-33588691 GAAAAGGGGTGGGGGCCACATGG + Intronic
1022933839 7:35151813-35151835 GGTTGGGGGTGGAGCCAAGATGG + Intergenic
1023619109 7:42051739-42051761 GGCTGGGGGTGGGGGTTATATGG - Intronic
1023649984 7:42359500-42359522 GGGTGGGGGGTGGGGCCAGCAGG + Intergenic
1023709014 7:42971844-42971866 GGATGGAGGTGGTCACCAGAAGG - Intergenic
1023839083 7:44085808-44085830 AGATGGGGGTGGGGCGCAGTGGG + Intergenic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1024339213 7:48239898-48239920 GGATGTTGGTGTGGGGCAGAGGG + Intronic
1024534723 7:50420588-50420610 GAAAGGGGGTGGGGGAAAGACGG - Intergenic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1026829003 7:73600286-73600308 CGAGTGGGGTGGGGGCGAGAGGG + Intronic
1026829055 7:73600443-73600465 TGAGTGGGGTGGGGGCGAGAGGG + Intronic
1026829131 7:73600639-73600661 CGAGTGGGGTGGGGGCGAGAGGG + Intronic
1026829146 7:73600678-73600700 CGAAAGGGGTGGGGGCGAGAGGG + Intronic
1026829162 7:73600718-73600740 TGAGTGGGGTGGGGGCGAGAGGG + Intronic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026843630 7:73684625-73684647 GGATGGGGGCGGGGGGAAGCTGG + Intronic
1026861452 7:73792743-73792765 GGAATGGGGTGGGGGCTAGGAGG + Intergenic
1027232345 7:76280357-76280379 AGATGGGGGAGGGGGCGAGGGGG - Intronic
1027232422 7:76280560-76280582 GGTGGGGGGCGGGGGCCAAAGGG - Intronic
1027770414 7:82399692-82399714 GGGTGGGGGTGGGGGCTGGGGGG - Intronic
1027870060 7:83695329-83695351 GTATGGGGGTGTGGGCTAGGGGG + Intergenic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1027991234 7:85363758-85363780 GGATGAGGGTGGGGGGAAAAAGG - Intergenic
1028374014 7:90126057-90126079 GGGTGGGGGTGGGGGGCAAGGGG + Intergenic
1028896600 7:96048478-96048500 GGTCTGGGGTGGGGCCCAGACGG - Intronic
1028985085 7:97003233-97003255 TGTGGGGGGTGGGGGACAGAAGG - Intergenic
1029110483 7:98211179-98211201 GGACGAGGGTGGGGGGCAGTAGG + Intergenic
1029113070 7:98223305-98223327 GGATGGGGGTGGGGGTGGGGAGG - Intronic
1029452244 7:100647570-100647592 AGGTGGGGGTGGGGGTCAGGTGG - Intronic
1029787494 7:102807176-102807198 TGAAGGGGGTGGGGGTCGGAGGG + Intronic
1030116503 7:106065704-106065726 GGATGGGGGGGGGCGCCTGGAGG + Intergenic
1030127250 7:106165966-106165988 GGTTGGGGGTGGGGGAGCGATGG - Intergenic
1030141141 7:106304936-106304958 TGATGGGGTTGCGGGCAAGATGG - Intergenic
1030423815 7:109345671-109345693 GGATGGTAGTGGGGGCTGGAGGG - Intergenic
1031155700 7:118108867-118108889 GTTTGGGGGTGGGGGGCTGAGGG + Intergenic
1031157624 7:118128194-118128216 GTCTGGGGGTGGGGGCCTGGGGG + Intergenic
1031160893 7:118166749-118166771 TAATGGGGGTGGGAGCCAGATGG + Intergenic
1031863721 7:127013534-127013556 GGATGGGGGATGGGGGCAGTGGG + Intronic
1032082690 7:128867923-128867945 TGATGGGAGTGGGGGCAGGAGGG + Intronic
1032091844 7:128915225-128915247 GGAGGGGGGAGGGGGGCGGAGGG - Intergenic
1032180281 7:129670175-129670197 GTCTGGGGGTGAGGGACAGATGG + Intronic
1032611072 7:133414910-133414932 GGTTGGGGGTAGGGGGCTGATGG - Intronic
1032845158 7:135745770-135745792 TGGTGGGGCTGGGGGCCAAAGGG + Intronic
1032916443 7:136495396-136495418 GGGGGGGGGTGGGGGCCGGGTGG - Intergenic
1033227382 7:139572758-139572780 GGGGGGGGGGGGGGGGCAGAGGG - Exonic
1033283570 7:140022424-140022446 AGATGGGGAGGGCGGCCAGAGGG - Intergenic
1033654261 7:143362507-143362529 GGATGGGGGAGGGGGTCGGAGGG + Intronic
1033756967 7:144403823-144403845 GGGTGGGGGTGGGGGTGAGGGGG - Intronic
1034463309 7:151210413-151210435 GGAGGGGGGGGGGGGGCAGGTGG + Intronic
1034553111 7:151833603-151833625 TGCTGGGGCTGGGGACCAGATGG - Intronic
1034839914 7:154386294-154386316 TGGTGGGGGTGGGGGGCAGGAGG - Intronic
1034847561 7:154460981-154461003 GGATGGTGGGGGTGGGCAGAGGG - Intronic
1035230546 7:157463516-157463538 GGATGGGGATGGGGGCGAGGTGG - Intergenic
1035291841 7:157844315-157844337 GGATGGGGCTGGGGCCTGGACGG - Intronic
1035301609 7:157901238-157901260 GGATGTGGGGGAGGGACAGATGG - Intronic
1035305491 7:157928856-157928878 GGATGGGGGGGTGGGACAGGGGG + Intronic
1035580737 8:737933-737955 GGTTGGGGGCGGGGGCGAGCGGG + Intronic
1035783130 8:2244362-2244384 TGATGGGGGTGGGAGACAGGTGG + Intergenic
1035808995 8:2475224-2475246 TGATGGGGGTGGGAGACAGGTGG - Intergenic
1035813676 8:2515164-2515186 GGATGGAGGTGGGGGCCCTGTGG + Intergenic
1036210504 8:6836462-6836484 GGATGGGGGTGGGGTGGAGCAGG + Intergenic
1036263546 8:7258095-7258117 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036264847 8:7265717-7265739 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036266148 8:7273339-7273361 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036267449 8:7280961-7280983 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036268751 8:7288583-7288605 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036270055 8:7296205-7296227 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036297841 8:7550850-7550872 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036299145 8:7558498-7558520 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036300450 8:7566148-7566170 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036301753 8:7573792-7573814 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036303050 8:7581441-7581463 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036315587 8:7716634-7716656 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036316895 8:7724282-7724304 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036318202 8:7731930-7731952 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036319511 8:7739578-7739600 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036320818 8:7747225-7747247 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036322128 8:7754873-7754895 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036323437 8:7762521-7762543 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036324732 8:7770168-7770190 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036351302 8:8014139-8014161 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036352607 8:8021785-8021807 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036353899 8:8029433-8029455 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036599955 8:10251674-10251696 GGATGTGGGTGTGGGGAAGATGG - Intronic
1036798527 8:11772901-11772923 GGTGGGGGGTGAGGGCAAGATGG - Intronic
1037009803 8:13827228-13827250 TGTTGGGGGTAGGGGGCAGAGGG - Intergenic
1037123035 8:15312996-15313018 GTAAGGGAGTGGTGGCCAGAAGG - Intergenic
1037442194 8:18927717-18927739 GGACGGGGCTGGGCACCAGAAGG - Intronic
1037459336 8:19093687-19093709 GGATGGGGATCGGGGCTGGAAGG - Intergenic
1037521089 8:19681393-19681415 CGATGGGGATGGGGGCGCGAAGG - Intronic
1037768234 8:21784652-21784674 GGATGGGCCTGGGGTACAGAAGG + Intronic
1037803961 8:22049264-22049286 GAAGGGGGGAGGGGGCGAGAAGG + Intronic
1037806831 8:22062651-22062673 TGATGGGGGTGCTGGCCAGGTGG - Intronic
1037881369 8:22575022-22575044 GGATGGGGGTGGGGGACTTGGGG - Exonic
1037936239 8:22916928-22916950 GGATGTAGGTGGAGCCCAGAGGG + Intronic
1038045954 8:23765637-23765659 GGGTGGGGGTGGGGGCGGGCGGG + Intergenic
1038447324 8:27612951-27612973 GGCGGGGGGTGGGGGGCAGGGGG + Intronic
1038498426 8:28023783-28023805 GGATTGGGGTGGGGGGAAGAGGG - Intronic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1039829338 8:41200568-41200590 GGATGGGGGTGAGGGCCAGAAGG - Intergenic
1039922301 8:41901931-41901953 GGATGGGACTGGGAACCAGATGG - Intergenic
1040342357 8:46447398-46447420 GGGTGGCTGTGTGGGCCAGAGGG - Intergenic
1040601795 8:48891967-48891989 GGATGTGGGTGGGGACTGGATGG - Intergenic
1040850763 8:51898832-51898854 GGATGCGCTTGGAGGCCAGAGGG - Intronic
1041054903 8:53974529-53974551 GGGTGGGGGTGGGGGGGGGACGG + Intronic
1041358255 8:57022503-57022525 GGAGGGAGGTGGGGGCCACCTGG + Intergenic
1041631740 8:60096470-60096492 GGAGGGGAGTGGGGGTCAAAAGG - Intergenic
1045253015 8:100496913-100496935 GGATGGGGGTGGGGGGTGGCAGG + Intergenic
1045336149 8:101205742-101205764 CGAGCGGGGTGGGGGCCAGAAGG - Intronic
1045622761 8:104001678-104001700 GGATTGGGATGGAGGTCAGAGGG - Intronic
1045680971 8:104659478-104659500 GGATGAGGGTGGGAGCCCAAAGG - Intronic
1045994963 8:108351936-108351958 TGTTGGTGGTGGTGGCCAGAGGG + Intronic
1047525850 8:125633470-125633492 GGTTGGGGGGCGGGGGCAGAGGG - Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1047903566 8:129449409-129449431 GGAAGGGAGTGGGGGGGAGAGGG + Intergenic
1048472078 8:134712814-134712836 GGCTGGGGGTTGGGGTGAGACGG - Intronic
1049293791 8:141818839-141818861 GGCTGAGGGTGGGGGCAAGCAGG - Intergenic
1049368228 8:142251181-142251203 GGAAGGCGGTGGGGGCCTGTAGG - Intronic
1049422061 8:142521394-142521416 GGATGGGGCTGGAGACCACAGGG - Intronic
1049488123 8:142876951-142876973 GGACGGGGATGGGGGACTGAAGG - Intronic
1049493008 8:142914974-142914996 GGATGGGGATGGAGGACTGAAGG - Intronic
1049594142 8:143475770-143475792 GGTGGGGGTTGGGGGCCAGAGGG - Intronic
1049709150 8:144055932-144055954 GGATGGTGCTGGGGAGCAGAGGG + Exonic
1049736933 8:144213192-144213214 GGATGGGGCTGAGGGCCACATGG - Intronic
1050036909 9:1445780-1445802 GGGTGGGGGTGAGGAACAGAGGG + Intergenic
1050214709 9:3309577-3309599 GAATGGGGGTGGGGAGGAGAGGG + Intronic
1050985639 9:12078661-12078683 GGAAGGGGGTGGGGGGAAGGAGG - Intergenic
1051082162 9:13306669-13306691 GGATGGGGGTGGAGCCAAGATGG - Intergenic
1051108745 9:13610719-13610741 GGATGGTTGTGGGTGCCACATGG + Intergenic
1051791237 9:20804860-20804882 GGCGGGGGGTGGGGGTCACAGGG + Intronic
1052115799 9:24647028-24647050 GGAGTGGGGTGGGGCCAAGATGG - Intergenic
1052904068 9:33818053-33818075 GGATGGGGGAGGGGGCTGCACGG - Intronic
1053157701 9:35792028-35792050 GGGTGGGGGTGGGGGGCGGGTGG - Intergenic
1053166876 9:35851229-35851251 TGGCGGGGGTGGGGGGCAGAAGG - Intronic
1053195026 9:36110793-36110815 GGAGAGGGGTGGGGGCCGGGTGG + Intronic
1054832798 9:69645013-69645035 GGATGGGAGTGGGGGACTGGGGG + Intronic
1054971591 9:71094087-71094109 GGGTGGGGGTGGGGGGCAAGGGG + Intronic
1055350179 9:75378554-75378576 GGATGGGGGAGGGTGGCAGGAGG + Intergenic
1055572913 9:77634491-77634513 GGAAGGGAGTGAGGGACAGAGGG + Intronic
1056395356 9:86176526-86176548 GGAAGGCGGTGGGGGGCAGGGGG - Intergenic
1056502555 9:87224029-87224051 GGATGTGGGAGGAAGCCAGAGGG - Intergenic
1056740546 9:89250701-89250723 GGGAGGGGGTGGGGGACAGCAGG + Intergenic
1056798978 9:89678231-89678253 GGGAGGGGGTGGGAGGCAGAGGG + Intergenic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1057171962 9:92968402-92968424 GAATTGGGATGGGGGTCAGAGGG - Intronic
1057272439 9:93658572-93658594 GTCTGTGGGTGGGGGACAGATGG + Intronic
1057292299 9:93814444-93814466 AGGTGGGGGTGGGGGCTTGAAGG - Intergenic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057587733 9:96344725-96344747 GGATGGGGGAGGGGGAGGGATGG + Intronic
1057768543 9:97945490-97945512 GTCTGGGGGTGGGGGGCAGGGGG - Intergenic
1057938332 9:99259038-99259060 GGCTGGGGGTGGGGCGCAGGGGG - Intergenic
1058592837 9:106583800-106583822 AGATGGGAGTGGGGGACAGTTGG - Intergenic
1059464431 9:114458765-114458787 GGGTGGGAGTGGGAGACAGAAGG + Intronic
1060110392 9:120902572-120902594 GGATGGGGGAGGGAGTCAGAAGG - Exonic
1060112481 9:120916674-120916696 GGGTGGGGGTGGGGGCAGGGTGG - Intronic
1060402920 9:123358440-123358462 AGAAGGGGGTGGGGGCCTGCAGG + Intronic
1060495753 9:124117660-124117682 GGATGGGGTCAGGGACCAGATGG + Intergenic
1060807697 9:126587977-126587999 GGATGGGGGCGGGGGATGGAGGG + Intergenic
1060892465 9:127197496-127197518 GCATGGGGGTGGGGGGCGGGAGG + Intronic
1060936597 9:127519670-127519692 GGATGGGGACGGGGGCCTGTGGG + Intronic
1061168155 9:128936512-128936534 AGGTGGGGGTGAGGGCCAGGAGG + Intronic
1061196485 9:129109864-129109886 GGGTGGGGAAGGGGGCTAGAGGG + Intronic
1061209842 9:129184746-129184768 GGCTTGGGGTGGGGCCTAGAGGG + Intergenic
1061218355 9:129235004-129235026 GCATGGGGGTGGGGGCAGGGTGG - Intergenic
1061263736 9:129494034-129494056 GGATAAGGGTGGGGGGCAGTGGG + Intergenic
1061306439 9:129735775-129735797 AGGTGGGGGTGGGAGACAGATGG - Intergenic
1061399646 9:130361447-130361469 GGATGGTGCTGGTGGCCATATGG + Intronic
1061403760 9:130382658-130382680 GGCTGGGGGTGGGGGAGAGGGGG - Intronic
1061488774 9:130933931-130933953 AGATGGGGGTGGGCGGCAGGAGG - Intronic
1061546947 9:131309847-131309869 GGAAAGGGGTGAGGGCCAGGAGG + Intergenic
1061642404 9:131969627-131969649 GGATTGGAGAGGGAGCCAGATGG + Intronic
1061673595 9:132202801-132202823 GGCTTGGGGTGAGGTCCAGAAGG + Intronic
1061800000 9:133108643-133108665 GGACTGGGGTGGGTGCCAGAGGG - Intronic
1061802793 9:133121272-133121294 GGCTGGGGGGCGGGGCCGGAGGG + Intronic
1061853271 9:133428565-133428587 GGGCGGGGGTGGGGGCGGGACGG - Intronic
1061869460 9:133513097-133513119 GTATGGGGGAGGGGCCTAGAGGG + Intergenic
1061874102 9:133535367-133535389 GGAGGGAGGTGGGGGGCAGGCGG + Intronic
1061907751 9:133707580-133707602 GGATGGGCGGGGAGGCAAGAGGG - Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062032081 9:134366297-134366319 GCATGGGGGGGGTGGGCAGAGGG - Intronic
1062107558 9:134764120-134764142 GCATGGGGGTGGGGGGTACAGGG + Intronic
1062164376 9:135099810-135099832 GGAGGGGGGTCTGGGCCAGATGG + Intronic
1062216663 9:135393078-135393100 GGTTGGGTGTGGGGGCTGGAAGG - Intergenic
1062282203 9:135757096-135757118 GGGTGGGGGTGGGGCCCAGCAGG - Intronic
1062300723 9:135866739-135866761 GGGTGGGGGTCGGGGGCAGGTGG - Intronic
1062340241 9:136090912-136090934 GGCTGGGGGCGGGGAACAGAGGG - Intronic
1062360291 9:136185065-136185087 GCCTGGGGGTCGGGGCCACATGG - Intergenic
1062389414 9:136327970-136327992 GGAAGGGGGTGGGGGGCCGGGGG + Intronic
1062490148 9:136801051-136801073 GGATGGGGCGGGGAGCCAGCTGG + Intronic
1062521343 9:136959239-136959261 GCATGGGGGTAGGGGCCAGCAGG - Intergenic
1062592842 9:137281720-137281742 GGGTGGGGGTGGGGGCTACCAGG + Exonic
1062640588 9:137516094-137516116 GGATGGGGGTGGGGCGCATGGGG - Intronic
1062695479 9:137873664-137873686 GGATGGGGGTGGGGGACAGGGGG + Intergenic
1203744704 Un_GL000218v1:35362-35384 GGAGGGGAGTGGGGGTCTGAAGG + Intergenic
1203565400 Un_KI270744v1:84122-84144 GGAGGGGAGTGGGGGTCTGAAGG - Intergenic
1185451615 X:283690-283712 GGGTGGGGGCGAGGGCAAGAGGG + Intronic
1186614466 X:11172109-11172131 GGATGAGAGTGGGGTTCAGAGGG - Intronic
1187051099 X:15696285-15696307 GGAAAGAGGTGGGGACCAGAAGG - Intronic
1187059848 X:15775826-15775848 GGAAAGAGGTGGGGACCAGAGGG - Intronic
1187155557 X:16717812-16717834 GGATGGGGGTGGGGGGAATGGGG - Intergenic
1187253866 X:17623482-17623504 GGATGGGGGTAGGGGGGAGGTGG + Intronic
1187475409 X:19606593-19606615 GGATGGGGGAGGAAACCAGAAGG + Intronic
1187602248 X:20845440-20845462 GGATGGGGGTGGAGCCAAGATGG + Intergenic
1187768194 X:22666528-22666550 GAATGGGGGTGGGGGCGGGGCGG - Intergenic
1187862400 X:23694785-23694807 GGATGGGGGTGGGGGCGGGGGGG + Intergenic
1187991416 X:24877498-24877520 GGCTGGAGGAGGGGGCCTGAGGG + Intronic
1188002762 X:24997649-24997671 GGAGAGGGATGGGAGCCAGAGGG - Intergenic
1188263379 X:28042186-28042208 GGTTGGGGGTGGGGGCGTAAGGG + Intergenic
1188376897 X:29442360-29442382 GGAGGGGGGTGAGGGATAGAAGG + Intronic
1188485715 X:30679668-30679690 GAATGGGGGAGGGGTGCAGAGGG - Intronic
1189037096 X:37505044-37505066 GGATGGTGGTGGTGGCGAGGGGG - Intronic
1189129307 X:38481696-38481718 GGATGGGGGTGGAGGAAGGATGG - Intronic
1189160004 X:38801663-38801685 GGGGAGGGGTGGAGGCCAGAAGG + Intronic
1189178407 X:38980866-38980888 GGCTGGGGGTTGGGGGAAGATGG - Intergenic
1189273357 X:39767300-39767322 GGGTGGGGGTGGGGGCGGGATGG + Intergenic
1189309475 X:40009523-40009545 GGATGGGGGGAGGGGAAAGAAGG - Intergenic
1189328885 X:40130712-40130734 GAATAAGGGTGTGGGCCAGAGGG + Intronic
1189333231 X:40155456-40155478 GGAAGGGGGTGGGGAGCAGGCGG + Intronic
1189334635 X:40163575-40163597 GGGTGGGGGTGGGGGTGGGAAGG - Intronic
1189409952 X:40761189-40761211 GGATGGCGGTGCAGGCCACAAGG + Intergenic
1190048306 X:47129986-47130008 AGCGGGGGGTGGGCGCCAGAAGG - Intergenic
1190109280 X:47579517-47579539 GGATGGGTGTGGGGGCCCATGGG - Intronic
1190279950 X:48922939-48922961 GGATGGGGTGGGGGGCAACAGGG + Exonic
1190626883 X:52345385-52345407 GGATGTGGGTGGGTGACAGCAGG - Intergenic
1190701107 X:52990422-52990444 GGATGTGGGTGGGTGACAGCAGG + Intronic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191104630 X:56764809-56764831 GGGTAGGGGTGGGGGCCACAGGG + Intergenic
1191826098 X:65365804-65365826 GGACAGGGGTGGGGGTCACAAGG - Intergenic
1191955664 X:66640018-66640040 GGAAGGGTTTGGGGGCCAGTAGG + Intergenic
1192456842 X:71283344-71283366 AGCTGGGGGTGGGGGTCGGAAGG - Intronic
1192656460 X:72999875-72999897 GGGTGGGGGTGGGGGCAGAAAGG - Intergenic
1192665660 X:73083126-73083148 GGGTGGGGGTGGGGGCAGAAAGG + Intergenic
1192859297 X:75048545-75048567 GGATGGGGGTGGGGGATATATGG + Intergenic
1193096698 X:77556406-77556428 AGGTGGGGGTGGGGGAGAGAGGG + Intronic
1193671371 X:84390173-84390195 TGATGGGGGAGGGGACAAGATGG - Intronic
1193917166 X:87379433-87379455 TGATGGTGGTGGTGGCCAGAAGG + Intergenic
1194489566 X:94530112-94530134 GGCTAGGGGTGGGGCCAAGATGG + Intergenic
1195006985 X:100695008-100695030 GGGTGGGGGTGGGGACAAAAGGG - Intronic
1195290628 X:103429241-103429263 GGGTGGGGGCGGGGGTCACAAGG + Intergenic
1195291591 X:103435226-103435248 GGGTGGGGGCGGGGGTCACAAGG + Intergenic
1195308772 X:103609619-103609641 GGGTGGAGGTAGGGGCCAGAGGG + Exonic
1195883313 X:109615114-109615136 GGATGCGGCTGGGGGCTTGAGGG + Intergenic
1196308543 X:114133337-114133359 GGAGGGGGGTGAGGGACAAAAGG + Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197346051 X:125326682-125326704 GGAAGAGGGTTGGGGCCAGCAGG + Intergenic
1197433541 X:126396826-126396848 GAATGGGGGTGGGAGACAAAGGG - Intergenic
1197730394 X:129804863-129804885 GGGTGGGGGTGGGGGTTGGAAGG - Exonic
1198271292 X:135058756-135058778 GGATGGGGGTTGGGGAAGGATGG - Intergenic
1198310596 X:135424006-135424028 GGAGGGGTGTGGGGGCCTGCAGG - Intergenic
1198563219 X:137874753-137874775 GGCTGGGGGAAGGGGCCAAAGGG + Intergenic
1198637018 X:138711794-138711816 GGGTGGGGGTGGGGGTGGGAGGG - Intronic
1199308336 X:146293243-146293265 GAATGGGGGAGGGGCCAAGATGG - Intergenic
1199544680 X:148995475-148995497 GGGTGGGGGTGGGGGCGGGGGGG + Exonic
1199712046 X:150476576-150476598 GGATGTGGATGGAGGCCAGTTGG + Intronic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1200051006 X:153431689-153431711 GGCTGGGGGTGAGGGAGAGAAGG + Intergenic
1200055052 X:153455925-153455947 GGCTGAGGCTGGGAGCCAGAAGG - Intronic
1200060637 X:153482280-153482302 GGCTGGGGTTGGGGGCCTGCTGG - Intronic
1200135182 X:153871276-153871298 GGATGGACGAGGGGGCGAGAGGG + Intronic
1200163038 X:154018996-154019018 AGATGGCGGTGGAGGCCACAGGG + Exonic
1200216222 X:154369325-154369347 GGACTGGGGTGGGGGCCTGATGG - Intronic
1200289973 X:154862534-154862556 GGAGGGGGGTGTGGGTTAGAAGG - Intronic
1201158046 Y:11150403-11150425 GGAGGGGAGTGGGGGTCTGAAGG + Intergenic
1201564899 Y:15355504-15355526 GGAAGAGGGTGGAGGCCAGAGGG - Intergenic