ID: 1120119529

View in Genome Browser
Species Human (GRCh38)
Location 14:80661861-80661883
Sequence GAATGCAAAGTGTCTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120119529 Original CRISPR GAATGCAAAGTGTCTTGTGG AGG Intronic
903006499 1:20302364-20302386 GAATGAAATGTGTCATGGGGTGG - Intronic
905677644 1:39839464-39839486 GAAAGTAATTTGTCTTGTGGTGG - Intergenic
909287820 1:73843214-73843236 GAATGAAAAGGGTCATTTGGGGG + Intergenic
910387731 1:86704029-86704051 GAAAGCAAAGTGCCAGGTGGAGG - Intergenic
911300052 1:96161444-96161466 GGATACAAAGTTTCTTTTGGGGG + Intergenic
913219598 1:116648813-116648835 GAATGCCAAGTGCCTTGCAGAGG - Intronic
914439124 1:147687703-147687725 GAATCAAAAGTGTATTGTGCTGG + Intergenic
916482057 1:165223004-165223026 GAATACAGAGTTTCTTTTGGTGG + Intronic
917729511 1:177860912-177860934 GTATGGAAAGTGGCTTGTAGAGG - Intergenic
919783854 1:201244292-201244314 GAATGCAAAGCATCTTTTGTAGG + Intergenic
920834808 1:209500871-209500893 GAATATAATGTGTCTTATGGAGG + Intergenic
922124219 1:222707000-222707022 GAACACTAGGTGTCTTGTGGGGG + Intronic
922814003 1:228436326-228436348 GAATGCAAAGTCTGTTTTAGAGG - Intergenic
923086403 1:230706322-230706344 GAATGCAGAGTGGCCTGGGGGGG - Intronic
923877847 1:238069461-238069483 GAATGAAATGTGTAGTGTGGGGG - Intergenic
1062849017 10:728979-729001 GAAGGCATGGTGTCTTGGGGAGG - Intergenic
1067013307 10:42734854-42734876 GAATGCAAAGTATAATGTTGAGG - Intergenic
1067448248 10:46366188-46366210 GAATGCCAAGAGTTTTGTGGCGG - Intergenic
1067589129 10:47494578-47494600 GAATGCCAAGAGTTTTGTGGCGG + Intergenic
1067636254 10:48002669-48002691 GAATGCCAAGAGTTTTGTGGCGG + Intergenic
1067877233 10:50017658-50017680 GAATGCCAAGAGTTTTGTGGCGG - Intergenic
1068569611 10:58615077-58615099 TAATGAAAAGTGTCTCGGGGGGG - Intronic
1068863402 10:61869298-61869320 GAAGGTAAAGTGACTTGTAGTGG - Intergenic
1068978348 10:63035078-63035100 TAGTGAAAAGTGTCTTGTTGTGG - Intergenic
1070132815 10:73666674-73666696 GAATGCCAAGACTTTTGTGGCGG + Intergenic
1071608864 10:87017400-87017422 GAATGCCAAGAGTTTTGTGGCGG - Intergenic
1071790167 10:88945119-88945141 AAATTCAAAGTATCTTCTGGTGG - Intronic
1071887280 10:89964802-89964824 GAATGGAAAGTGAGTTGTGATGG - Intergenic
1074107498 10:110399388-110399410 GAATGCAATGTGCATTCTGGTGG - Intergenic
1074120240 10:110488602-110488624 GCTTGCTAAGTGTCTTTTGGTGG + Intergenic
1078207504 11:9243251-9243273 GAATGTTTAGTGTTTTGTGGAGG - Intronic
1078832105 11:14987726-14987748 GCATTCAAAGTGCCCTGTGGAGG - Intronic
1079114811 11:17634379-17634401 AAAAGCAAAGTGTCTTGTAGGGG + Intronic
1079649973 11:22915661-22915683 TAAACCAATGTGTCTTGTGGTGG - Intergenic
1081534164 11:43985238-43985260 GAAGGCAAAGTGTTTTGAGAAGG + Intergenic
1085801299 11:79592437-79592459 AGATGCATAGTGTCTTGTGGAGG + Intergenic
1088840603 11:113624547-113624569 GAAAGGCAAGTGTCCTGTGGAGG - Intergenic
1089161286 11:116439573-116439595 GTGTGGAAACTGTCTTGTGGGGG + Intergenic
1089209172 11:116789087-116789109 CCATGCACAGTGTCCTGTGGGGG + Intergenic
1091047674 11:132338681-132338703 GAATGCAAGGTGGATTGTGAGGG + Intergenic
1091836093 12:3586828-3586850 GAAAGCAAAGAGTCTTGGTGAGG - Intronic
1093029351 12:14273885-14273907 GTATGCTAAGTGTCTGGTGGTGG + Intergenic
1093831229 12:23761081-23761103 GAATGGAAGTTGTCTTCTGGAGG + Intronic
1098471861 12:70854355-70854377 GAATGCAGTGTGTCTCGTTGTGG - Intronic
1099228854 12:80000284-80000306 CAATGGAAAGTGACTTTTGGGGG + Intergenic
1099463676 12:82955941-82955963 GAATTTAAAGTGCCTTTTGGGGG - Intronic
1101832414 12:108269534-108269556 GAAAGCAAAGTGTCTTTTTCAGG + Intergenic
1103054113 12:117805116-117805138 GAATGCCAAATGTCTTGGAGAGG - Intronic
1107449592 13:40496679-40496701 GATTGGAAAATGTATTGTGGTGG - Intergenic
1109923057 13:69094648-69094670 GAATGGAAAATGTCTTGAGTTGG + Intergenic
1114080009 14:19195620-19195642 GAATGTCTAGTGACTTGTGGGGG + Intergenic
1117073964 14:52082147-52082169 AAATGCAAAGTGTGTAGTGGAGG - Intergenic
1120119529 14:80661861-80661883 GAATGCAAAGTGTCTTGTGGAGG + Intronic
1121419009 14:93799254-93799276 GAATGCAAAGCGTCCTCTGCAGG - Intergenic
1125001690 15:34777460-34777482 GAATACAAAGTTTTTTGGGGGGG + Intergenic
1126413627 15:48396277-48396299 GAATGGAGAGTGACTTGTGATGG + Intergenic
1126783206 15:52155885-52155907 TAATGAAAAGTGTCTTGTTAGGG + Intronic
1127708108 15:61567303-61567325 TATTGCTAAGTGTCTTCTGGGGG - Intergenic
1131799378 15:96053511-96053533 GAATGCAAAGAGTCATCTGGAGG - Intergenic
1133559310 16:6935750-6935772 GAATGGAAAGTGCTTTGTAGAGG + Intronic
1136112526 16:28073589-28073611 GAACTCACAGTGTCTTCTGGGGG - Intergenic
1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG + Intergenic
1138719516 16:59062942-59062964 GAAAGCAAAGTGGTGTGTGGAGG - Intergenic
1141448509 16:84080420-84080442 GACTTCTCAGTGTCTTGTGGGGG - Intronic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1144577323 17:16437284-16437306 GAAAGCAAAGGGTGTCGTGGTGG - Intergenic
1148156472 17:45427709-45427731 AGATGCAAAGCGACTTGTGGAGG + Intronic
1148584529 17:48768033-48768055 CAAGGCAAAGTGCCTAGTGGGGG + Intronic
1150179674 17:63103925-63103947 GAAAGTAAAATGTCTTGTGGAGG + Intronic
1150388145 17:64776340-64776362 AGACGCAAAGTGACTTGTGGAGG + Intergenic
1150458355 17:65326492-65326514 GAAGGAAAAGTGTCTTGTCTAGG + Intergenic
1150791307 17:68201610-68201632 AGATGCAAAGTGACTTGTGGAGG - Intergenic
1152841607 17:82572429-82572451 GATTTCAAAGTGTCTCTTGGGGG - Intronic
1154014887 18:10607518-10607540 GAAAGCAAAGGGGCTTGGGGCGG + Intergenic
1154190605 18:12228060-12228082 GAAAGCAAAGGGGCTTGGGGCGG - Intergenic
1155234755 18:23808049-23808071 GAGTGGGTAGTGTCTTGTGGGGG + Intronic
1156032118 18:32724727-32724749 CAATGCAGAGTGTCATATGGTGG + Intronic
1157024571 18:43827636-43827658 GTATTCAAAGAGTCTTGTGAAGG - Intergenic
1159554270 18:69928919-69928941 GAATGCAAAGTGACTTTGGAAGG + Intronic
1161072126 19:2267822-2267844 GGATGCAGAGTCTCTTGGGGGGG + Intronic
1162101207 19:8340322-8340344 GTATGCAAAGTGTTGTATGGGGG - Intronic
1164917023 19:32060033-32060055 AAATGCAAAGTGTAGTGCGGAGG + Intergenic
1167198724 19:48049243-48049265 AAATGCAAAGTGTCTGGAGTGGG - Intronic
927604834 2:24477479-24477501 GATTGCAAAGTGTAGGGTGGAGG - Intergenic
928006202 2:27564225-27564247 GAGTACAAATTTTCTTGTGGTGG + Intronic
930052699 2:47228866-47228888 GGATGCAAATTGTTATGTGGGGG + Intergenic
934694113 2:96386281-96386303 GGATACAAAGTTTCTTGTAGGGG - Intergenic
936275396 2:111091947-111091969 GAAGGCAAATTGTCTTCTAGTGG + Intronic
936394280 2:112109047-112109069 GAATGCAAACTGCCTTGCTGGGG + Intronic
936394285 2:112109096-112109118 GAATTCAAACTGTCTTGTTGGGG + Intronic
939815004 2:146883553-146883575 CAATGCAAAGTATACTGTGGAGG - Intergenic
940005959 2:149009877-149009899 AGATGGAAAGTTTCTTGTGGTGG + Intronic
940041321 2:149364140-149364162 GAATGCAAAGTCATTTGTGGTGG + Intronic
940058078 2:149534509-149534531 GAATGAAAAATGTCTTGGGTGGG - Intergenic
940203883 2:151181026-151181048 GAAGGCTACGTGTGTTGTGGGGG + Intergenic
940256938 2:151741191-151741213 GAATGCATAGAGACTTTTGGGGG - Intergenic
940285079 2:152026058-152026080 TCATGCCAAGTGACTTGTGGTGG - Intronic
940391762 2:153140683-153140705 GAGGGCAAAGTTCCTTGTGGTGG - Intergenic
942907231 2:181198651-181198673 TAAAGCAAACTGTTTTGTGGTGG + Intergenic
944903487 2:204239725-204239747 GAATGAAAAGAGGATTGTGGAGG + Intergenic
948443281 2:238011806-238011828 GCATGGAAAGTGTCTTGTTATGG + Intronic
948651351 2:239446453-239446475 GAAGGCGAAGTGTCTTGTCCTGG + Intergenic
948841203 2:240650318-240650340 GAGAGCAAAGCGTCTTGCGGTGG + Intergenic
1170761651 20:19256357-19256379 GGATGCAAAGTGTCTTTTTGGGG + Intronic
1177414860 21:20780443-20780465 AAATTCAAGGTGGCTTGTGGCGG + Intergenic
1179205678 21:39275485-39275507 GAATGAAAAGTGTCTAGGGCAGG - Intronic
1180500762 22:15927080-15927102 GAATGTCTAGTGACTTGTGGGGG - Intergenic
1180579269 22:16814427-16814449 GAATGGAAAGTGTATTGTTTTGG + Intronic
1180820888 22:18826871-18826893 GAATGCCAAGTGCCTTGCAGAGG - Intergenic
1181192089 22:21149174-21149196 GAATGCCAAGTGCCTTGCAGAGG + Intergenic
1181207108 22:21261336-21261358 GAATGCCAAGTGCCTTGCAGAGG - Intergenic
1203219812 22_KI270731v1_random:34080-34102 GAATGCCAAGTGCCTTGCAGAGG + Intergenic
1203271015 22_KI270734v1_random:52747-52769 GAATGCCAAGTGCCTTGCAGAGG - Intergenic
949099881 3:130964-130986 AAATGCAAGGTGTTCTGTGGTGG - Intergenic
951549282 3:23861066-23861088 GAATGCAAACTGTCTTTTTCTGG - Intronic
951602277 3:24389614-24389636 GAATGCAAAATGTAATTTGGGGG + Intronic
952445497 3:33377381-33377403 GAATTCAAAGTGACTTGGAGTGG + Intronic
952708069 3:36400086-36400108 GAAAGCAAAGTGTTTAGTGCTGG - Intronic
954286462 3:49623067-49623089 GATTGCAGAGTATCTTGGGGTGG + Intronic
956604611 3:71061124-71061146 GAATGCAAAATGTCACTTGGTGG + Intronic
957686894 3:83514000-83514022 GCCTGCAAAGTCTTTTGTGGGGG - Intergenic
963865254 3:150353805-150353827 GGATGCCAAGTGTGTTCTGGGGG - Intergenic
965757844 3:172042463-172042485 GAAGGGAAAGTGACTTGTTGAGG + Intronic
966035132 3:175402804-175402826 GAATGCATAGGCTGTTGTGGTGG - Intronic
966465725 3:180228937-180228959 AAATGCAAGGTGGTTTGTGGAGG - Intergenic
966682911 3:182662241-182662263 GGATGATAAGTGTCTTGTGGAGG - Intergenic
967951172 3:194841945-194841967 GAATGAAAAGGGTGGTGTGGAGG - Intergenic
968790702 4:2659202-2659224 GAATGAAAAGTGGCACGTGGAGG - Intronic
970641491 4:18071077-18071099 GAAAGCAGAGGGTCTTTTGGAGG + Intergenic
971085890 4:23274548-23274570 GAATACAATGTGATTTGTGGAGG - Intergenic
972103595 4:35453295-35453317 GAATGCAAAATGGCATTTGGTGG + Intergenic
972188433 4:36561025-36561047 GAATGCAAAGTTTCTTGTATAGG + Intergenic
974369857 4:61001297-61001319 GATTATAAAGTGTCTTGTTGTGG - Intergenic
975724290 4:77277029-77277051 GCATGCACAGGGTCATGTGGGGG + Intronic
978023003 4:103837112-103837134 GCATGTAGAGTGTGTTGTGGGGG + Intergenic
978405908 4:108378369-108378391 GAATGCAAGGTGCCTGGAGGTGG - Intergenic
982604832 4:157501521-157501543 GAATGCAAAGATTATTCTGGGGG + Intergenic
987240408 5:15992719-15992741 GAATCCAAGGTGTCCTGTGAAGG - Intergenic
988551468 5:32204542-32204564 GAATCCAAAGGGTCTTGTGCAGG - Intergenic
991678551 5:69114109-69114131 GTATGCAATGTGTCTTTTAGAGG + Intronic
992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG + Intergenic
993535622 5:89082294-89082316 ATATGCAAAGTTTCTTTTGGGGG - Intergenic
998061326 5:139120992-139121014 GAATTCAAAGTGTGTTTTGTGGG + Intronic
999467830 5:151823719-151823741 GGCTGCAAAGTATCTGGTGGGGG - Intronic
1004839842 6:19570343-19570365 GAATGAAGAGTGTGTTCTGGAGG + Intergenic
1005094594 6:22100710-22100732 GATTTTAAAGTGCCTTGTGGTGG - Intergenic
1006167787 6:32075359-32075381 GAATGCAGTATGTTTTGTGGTGG - Intronic
1006342833 6:33456025-33456047 GAAACCAAAGTGTTTTCTGGAGG + Exonic
1008317603 6:50065303-50065325 GAATGCCAAGTATGTAGTGGTGG - Intergenic
1009949132 6:70375604-70375626 CAATCCAAAGTGAGTTGTGGGGG - Intergenic
1010646646 6:78397063-78397085 CTATGCATAGTGTCTTGTGATGG + Intergenic
1011407006 6:87026201-87026223 GAATGAAAAGTGGCCTGTGGTGG + Intergenic
1011755790 6:90497164-90497186 GAATGGAAAGTATTTTTTGGGGG + Intergenic
1012491707 6:99789331-99789353 GATTGCAAAGTGGCATGAGGGGG + Intergenic
1013160109 6:107535010-107535032 GAATGCAAAGTATTTTGTTGTGG - Intronic
1013560210 6:111296198-111296220 CAAAGCAAAATATCTTGTGGAGG - Intergenic
1016156802 6:140820692-140820714 GGATGCAAAGAGTCATTTGGAGG + Intergenic
1016430291 6:143977087-143977109 GAAGGCTAAGTGTGTTGGGGGGG - Intronic
1018462938 6:164016556-164016578 GAATGCACAGTGTGTTATGTGGG - Intergenic
1019191015 6:170250826-170250848 GAATGCACAGGGTCTCATGGCGG - Intergenic
1020503447 7:8952907-8952929 CAACTCAAACTGTCTTGTGGAGG - Intergenic
1024885084 7:54131926-54131948 GAGTGCAAATTGGATTGTGGGGG - Intergenic
1028852782 7:95554925-95554947 AAAATCAAAGTGTCTTGTGCTGG + Intergenic
1032398061 7:131604947-131604969 GGATGCAAAGTGGCATCTGGTGG + Intergenic
1032912217 7:136446307-136446329 GACTGCACAGTGACTTGTGGAGG + Intergenic
1033151012 7:138915146-138915168 GAAGAGAAAGTGTCTTCTGGGGG - Intronic
1033956879 7:146860383-146860405 GAATGCAAAGTCTCTGAGGGTGG + Intronic
1039486212 8:37912088-37912110 AAAAGCAAATTGTCTAGTGGAGG - Intergenic
1039733209 8:40302074-40302096 GAATCCAAAGTGACTTGTAATGG + Intergenic
1040619666 8:49077397-49077419 GAAGGCCAAGTGTGTTGGGGAGG + Intergenic
1050802440 9:9632414-9632436 GAATGGAAAGTGACTTTTGATGG + Intronic
1052518606 9:29514293-29514315 GAATACACAGTGGCTTCTGGTGG + Intergenic
1057574303 9:96229431-96229453 AAATGCAAAATGTCTTCTAGGGG + Intergenic
1059721093 9:116960679-116960701 GATTGCCAAATGTCTTCTGGGGG + Intronic
1059936238 9:119313981-119314003 GAATGCACAAAGTCTTGTGATGG + Intronic
1060421267 9:123471353-123471375 GCATGGAAAGTGCCTAGTGGGGG + Intronic
1060603562 9:124894740-124894762 CATTGCCAAATGTCTTGTGGGGG - Intronic
1186473488 X:9838949-9838971 GAATACAAAGGATCTTTTGGGGG + Intronic
1186518684 X:10186442-10186464 GAATGGAAAGGGTGTTGTGTAGG + Intronic
1186875635 X:13814674-13814696 AACTACAAAGTGTCTTGTGTGGG + Intronic
1187036207 X:15542751-15542773 GAATGCACGGTATCTGGTGGTGG + Intronic
1187489155 X:19734669-19734691 GAATGGAAAGTGATTTTTGGTGG - Intronic
1195329959 X:103788791-103788813 GAATGAAAATTTTCATGTGGGGG - Intronic
1195608650 X:106838242-106838264 CAATAGAAAGTGTCTTGAGGGGG - Intronic
1199793590 X:151176305-151176327 GAATGCACAGGGGCTGGTGGAGG + Intergenic