ID: 1120121068

View in Genome Browser
Species Human (GRCh38)
Location 14:80680632-80680654
Sequence ATGTGGGTATGGACTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120121068_1120121073 -2 Left 1120121068 14:80680632-80680654 CCCTCTGCAGTCCATACCCACAT 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1120121073 14:80680653-80680675 ATGTATCTCCAAGAATCTGAAGG 0: 1
1: 0
2: 2
3: 12
4: 197
1120121068_1120121075 26 Left 1120121068 14:80680632-80680654 CCCTCTGCAGTCCATACCCACAT 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1120121075 14:80680681-80680703 CTCTCCTAGATTAGAAGTGTAGG 0: 1
1: 1
2: 10
3: 42
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120121068 Original CRISPR ATGTGGGTATGGACTGCAGA GGG (reversed) Intronic
901203697 1:7481969-7481991 AAGTGGGTATTGACTGCAAAGGG - Intronic
901217686 1:7563919-7563941 ATGGGGGTAAGCGCTGCAGAGGG + Intronic
901484513 1:9549300-9549322 ATGTGGGGATGAACTGCTGGTGG + Intronic
902700978 1:18171783-18171805 ATGTGGATATGGACTTCACGGGG + Intronic
904984632 1:34534810-34534832 ATGTGGGAGGTGACTGCAGAAGG - Intergenic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906662869 1:47594820-47594842 ATGTGGGCAGGTACTGCCGAGGG + Intergenic
909467252 1:75985942-75985964 ATCTAGGTATGGACCTCAGAGGG - Intergenic
909712523 1:78668145-78668167 ATGTGGTAATGAAGTGCAGATGG + Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
915689168 1:157670334-157670356 ATGTGGGTGTGGCCTTTAGAAGG - Intergenic
916231373 1:162544468-162544490 ATTTGGGTATGGACAGCTGAGGG - Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
918703351 1:187632313-187632335 AGGTGGGTCTGGCATGCAGATGG + Intergenic
921059924 1:211577689-211577711 GTGCGGGTGTGGACTGCAGCGGG + Intronic
921658004 1:217763643-217763665 ATGGGGGTAAGCACAGCAGATGG + Intronic
922769254 1:228173328-228173350 TTGCAGGTATGGACTGCACAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
924837552 1:247667664-247667686 ATGTGAGTGTTGACTGGAGAAGG - Intergenic
1062890651 10:1057096-1057118 AGGTGGGCTTGGAATGCAGAGGG + Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063360875 10:5456868-5456890 ATGTGGCTCTGGCATGCAGATGG + Exonic
1064029533 10:11875144-11875166 TTGTGGATTTGGAATGCAGAGGG - Intergenic
1064100631 10:12461006-12461028 AAGTAGGTAGTGACTGCAGAAGG + Intronic
1065424921 10:25590757-25590779 ATGTGCTTATGTAGTGCAGAAGG + Intronic
1070399307 10:76039171-76039193 ATATGGGAAGGGACTGCACAGGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1075074993 10:119344789-119344811 ATGTGCGTGTGGGGTGCAGAGGG + Intronic
1075508873 10:123052516-123052538 ATGTGGGTAAGGACACGAGATGG - Intronic
1075906833 10:126088916-126088938 ATCTGGGTGTAGATTGCAGAAGG + Intronic
1075955063 10:126516507-126516529 ATGAGGGTATCCACTTCAGAGGG + Intronic
1076449637 10:130547844-130547866 GTGTGGGTAAAGGCTGCAGAAGG - Intergenic
1076638085 10:131895955-131895977 GTGTGGGGATTGACTGGAGAGGG - Intergenic
1077794440 11:5477240-5477262 ATGTGGTTATTGGCTGCAAAGGG - Intronic
1085902319 11:80715974-80715996 ATGTGTGTAGGGGCTGTAGATGG + Intergenic
1085956749 11:81407261-81407283 ATGAGTATATGGACAGCAGAGGG - Intergenic
1087156439 11:94909447-94909469 AGATGGGAATGTACTGCAGATGG + Intergenic
1089426531 11:118380975-118380997 ATGTGGGAGGGGACTGCATAAGG + Intronic
1091287934 11:134418865-134418887 ATTTGGGGAAGGACTGGAGAAGG + Intergenic
1091406570 12:213202-213224 ATGTGGGTGTGGACTGAAGCAGG - Intronic
1091706514 12:2697154-2697176 GTGTGGGTATGGGCTGCAGCTGG - Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1096019464 12:48310980-48311002 ATGAATGTAAGGACTGCAGAAGG - Intergenic
1096919329 12:55067345-55067367 ATGAGGGTCTGAACTGCAGCTGG - Intergenic
1100809650 12:98325406-98325428 CTGTGGCTGTGGACTGCAGGTGG - Intergenic
1102106654 12:110330286-110330308 ATGTGGGTTTGGACTTCACAAGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1106601121 13:31187839-31187861 ATTTGGTTATAGACTGCAGGAGG - Intergenic
1108361125 13:49668860-49668882 ATGTTGGTAGTGAGTGCAGATGG - Intronic
1109860642 13:68193321-68193343 ACGTGGGAAGGGACTGCACAAGG + Intergenic
1113112118 13:106834453-106834475 GTGTAGGTGTGGACTGCAGAAGG + Intergenic
1117013651 14:51495960-51495982 ATGTGGGTAGGGACAACACAGGG - Intronic
1117754159 14:58956779-58956801 ATGGGGGTGGGGACTGCAGGTGG + Intergenic
1120121068 14:80680632-80680654 ATGTGGGTATGGACTGCAGAGGG - Intronic
1125854626 15:42937004-42937026 ATGTTGGAATGGCCTGCTGAAGG + Intergenic
1128953328 15:71911065-71911087 AAGTGGTTATTGACTGCAGATGG - Intronic
1131535412 15:93233068-93233090 ATGTGGATTTCGACTGCAGTGGG + Intergenic
1131601788 15:93856744-93856766 ATGTGGGTATGGGATGGTGAGGG + Intergenic
1132918565 16:2369352-2369374 AGGTGGCTATGGTCTTCAGATGG - Intergenic
1133160349 16:3907749-3907771 GTGTGGGCAGGGCCTGCAGAGGG + Intergenic
1133255992 16:4516461-4516483 ATGTGGAGATGGGCTGCAGTAGG - Intronic
1134034059 16:11016192-11016214 AAGTGGGTATGGACCTCAGTGGG - Intronic
1136578251 16:31136933-31136955 ATGGGGGGATGGGGTGCAGAGGG + Intergenic
1137512729 16:49115541-49115563 ATGGGAGAAGGGACTGCAGATGG - Intergenic
1141056407 16:80819247-80819269 ATGTGGTAATGGACTGGAGCTGG + Intergenic
1141157624 16:81608432-81608454 ATGTGGCTTTGGGCTGCAGGTGG - Intronic
1146639391 17:34528400-34528422 ATGTGTGCATGGACTACAAATGG + Intergenic
1147354045 17:39877339-39877361 ATGAGGGTATGGGGTGCAGTGGG - Intronic
1150853575 17:68729269-68729291 ATGTGGGTATAAACTGGAAATGG - Intergenic
1152486764 17:80599649-80599671 ATGTGAGAAGGCACTGCAGACGG + Intronic
1153463266 18:5361120-5361142 AAGGTGGTATGGACTGAAGAGGG - Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1157058326 18:44256498-44256520 ATATGGGTATGGTCAGAAGAAGG + Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158959257 18:62574953-62574975 GTGTGGGTAGGAACTGCAGGAGG - Exonic
1160939323 19:1612886-1612908 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1160939354 19:1613084-1613106 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1163334063 19:16660247-16660269 AAGGGGGTCTGGCCTGCAGAGGG - Intronic
1164682399 19:30144683-30144705 TTGAGGGTATGGCCTGCAGGAGG + Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1167318062 19:48777904-48777926 ATGTGGGAAAGGAATGCACATGG - Intergenic
1168593072 19:57652682-57652704 ATGTGGGCATGGCCTTCAGCGGG - Intergenic
1168666983 19:58211579-58211601 ATGTGGCTGTGGACTTCAGCCGG + Exonic
926632127 2:15146417-15146439 TTGTGATGATGGACTGCAGACGG + Intergenic
930416420 2:51095711-51095733 ATGTGGGTTTGAACTGCACAAGG - Intergenic
931513658 2:63027602-63027624 ATGTGGGTGCGGACTGCAAGTGG + Intronic
935513550 2:104005862-104005884 ATGTGAGCGTGAACTGCAGAGGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937823240 2:126335230-126335252 GTCTGGATATGGAATGCAGAGGG - Intergenic
938450915 2:131419102-131419124 ATGTGTTTACGGTCTGCAGAAGG - Intergenic
939081669 2:137670209-137670231 ATCTGGCTGTAGACTGCAGATGG - Intronic
940032160 2:149274930-149274952 TTGTGGGAATGGACTGAAGGAGG + Intergenic
940579011 2:155551696-155551718 ATGTGGTGATGGGCTGCATAAGG - Intergenic
946058520 2:216921243-216921265 ATGGGGGTGTGGTCAGCAGATGG + Intergenic
946882443 2:224190274-224190296 ATGTGGATATACAATGCAGAGGG + Intergenic
946946114 2:224824584-224824606 AGCTGGGTATGGACTACAGGAGG - Intronic
1169237688 20:3944773-3944795 ATGGGGGTAGGGATTGAAGAAGG - Intronic
1170789246 20:19494195-19494217 GGGTGGGTATGGACTATAGATGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171179276 20:23080654-23080676 ATGTGGGGATGAACTGCATGAGG - Exonic
1171264908 20:23763356-23763378 ACCTGGGTATGGAGTACAGAGGG - Intergenic
1171274554 20:23845047-23845069 ACCTGGGTATGGAGTACAGAAGG - Intergenic
1171966813 20:31536693-31536715 ATGTGTGCAGGGACTACAGAGGG - Intronic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173743854 20:45421423-45421445 GAGTGGCTATGGGCTGCAGAAGG + Exonic
1174331875 20:49826541-49826563 ATGTGCTTTTGGAGTGCAGATGG - Intronic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1175687315 20:61040959-61040981 ATGGGGGTATCTTCTGCAGAGGG - Intergenic
1181920534 22:26317110-26317132 AGGTGGGTAGAGACTACAGAGGG + Intronic
1183538014 22:38414262-38414284 ATGTGGGGACGGGGTGCAGATGG - Intergenic
1183543593 22:38443808-38443830 ATGTGGAGATGGACTGCGGGAGG - Intronic
1183954098 22:41368902-41368924 TTGTGGGTGTGGACTCCAAATGG - Intronic
1185107207 22:48880643-48880665 ATGTGGGTATGGACTCCACACGG - Intergenic
1185277945 22:49957823-49957845 ACCTGGGTACTGACTGCAGAGGG - Intergenic
1185330523 22:50250205-50250227 GTGTGGGTATGGCCTGCAAAGGG - Intronic
950950586 3:16994240-16994262 ATGTGAATTTGGACTGCAGAAGG - Intronic
955985308 3:64567701-64567723 ATGTGTGTATGGGATGGAGAAGG - Intronic
956893072 3:73631670-73631692 ATGCAAATATGGACTGCAGAAGG - Intergenic
960263328 3:115592797-115592819 ATGTGGGTAGGAACTACTGAAGG - Intergenic
960441791 3:117697657-117697679 ATGTGGTTATGGAATCCAGGAGG + Intergenic
960640435 3:119817585-119817607 ATGTGGGCATAGACCCCAGATGG - Exonic
960641803 3:119832016-119832038 GTGTGGGAATGGACTGCATTAGG - Intronic
961554457 3:127688629-127688651 GTGTGGGTATAGAATGGAGAGGG + Intergenic
962160742 3:132997583-132997605 ATGTGGTTAAGGACTGCACCTGG + Intergenic
966595408 3:181720634-181720656 ATGTGGTTATGTTCTGGAGACGG - Intergenic
972815357 4:42639082-42639104 ATGTGGGTTTGGACAGCTGTTGG - Intronic
973348375 4:49081695-49081717 GGGTGGTTATGGTCTGCAGATGG + Intergenic
978873894 4:113614374-113614396 ATGTGGGAGGGGACTGCACAAGG - Intronic
981591334 4:146366078-146366100 TGGTGGGTAGGGAATGCAGATGG - Intronic
982600121 4:157438860-157438882 ATCTGGGTAATGACTCCAGAAGG - Intergenic
983043346 4:162956309-162956331 ATGTGGGTATAAACTGAAAATGG + Intergenic
984173233 4:176385625-176385647 ATCTGAATATGGCCTGCAGATGG - Intergenic
986565673 5:9111299-9111321 AAATGGGTATGGAAGGCAGAGGG + Intronic
988066494 5:26232777-26232799 ATGTGGGCAGGGGATGCAGAAGG - Intergenic
988324577 5:29746201-29746223 CTGTGGACATGGACTGCTGATGG - Intergenic
989643020 5:43602081-43602103 CTGTGAGTTTGGACTGCAGTGGG + Intergenic
990279373 5:54232901-54232923 ATGTGTGCATGGACTCCTGAGGG + Intronic
993001709 5:82387742-82387764 AAGTGTGTGTGGACTGCACATGG + Intergenic
994799670 5:104356898-104356920 AGGTGGCTATGGACAGCAGCAGG + Intergenic
995207154 5:109493651-109493673 ATGTTGTTATGTACTCCAGAGGG - Intergenic
1000137630 5:158368084-158368106 ATGTGGGAATGGGCCGGAGACGG + Intergenic
1000238930 5:159390977-159390999 GTGTGGGTTTGAACTGCACAGGG + Intergenic
1001095750 5:168774236-168774258 GTGTCTGGATGGACTGCAGAGGG + Exonic
1005761930 6:28975439-28975461 CTGTGGGAATGGACTACAAAAGG + Intergenic
1005801171 6:29426833-29426855 AGCTGGGAATGGACAGCAGAGGG + Exonic
1006003197 6:30982796-30982818 ACTTGGGTATGGCCAGCAGAGGG - Intergenic
1007940823 6:45779672-45779694 ATGTGGGTATTGATGGCATAAGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1010988449 6:82452146-82452168 ATGTGGGTGTGGAGTACAAAGGG - Intergenic
1011691581 6:89874993-89875015 GTGAGAGTATGCACTGCAGAAGG - Intergenic
1012287061 6:97403482-97403504 ATATGTCTCTGGACTGCAGATGG + Intergenic
1014159694 6:118153875-118153897 GTCTGGGAATGGACAGCAGATGG + Intronic
1018688921 6:166327771-166327793 ATGTGGTTATAGAGTTCAGATGG - Intronic
1021979269 7:26038778-26038800 ATGGGGGTGTGGACTTCAGTAGG - Intergenic
1022183854 7:27948038-27948060 GGGTGGGTGTGGCCTGCAGATGG + Intronic
1022620108 7:31974743-31974765 GTGTGGGAATTGACTGCAAATGG + Intronic
1023219689 7:37906956-37906978 ATGTGTTTATGGTCTGCAGAAGG - Exonic
1025771297 7:64509956-64509978 AGGGGAGTATAGACTGCAGATGG - Intergenic
1026130080 7:67612897-67612919 ATATGGGGAGGGACTGCAGTGGG + Intergenic
1026158439 7:67848021-67848043 ATGAGGGTTTGGGCTGAAGAAGG - Intergenic
1028381971 7:90210669-90210691 ATCTGTGTATGGACTACAAAGGG + Intronic
1028480482 7:91299447-91299469 ATGGGAGTGGGGACTGCAGAGGG - Intergenic
1028824572 7:95255828-95255850 AAGTGGGCTTTGACTGCAGAAGG + Intronic
1036630549 8:10511227-10511249 ATGTGGGAAGGGACTGTGGAAGG - Intergenic
1039504229 8:38040312-38040334 ATTTGGGTATGCACAGCAAAGGG + Intronic
1039540082 8:38359495-38359517 ATGTGGGTGTGGACTTCTGGAGG + Intronic
1041701777 8:60798165-60798187 ATGTGGGAAAGTATTGCAGATGG + Intronic
1041751666 8:61267422-61267444 ATGTGTGTATGTATTGGAGATGG - Intronic
1045308762 8:100982297-100982319 ATGTGGGAGGGGACTGCACAAGG + Intergenic
1045322298 8:101091373-101091395 ATGAGGGTATGGCCTGGATATGG + Intergenic
1047154563 8:122302480-122302502 GTGTGGGTAAGGATTGCAAAAGG - Intergenic
1048434451 8:134403045-134403067 ATGTGGGTGTGGATACCAGAAGG - Intergenic
1048588266 8:135796225-135796247 ATGTGAGAATGGACTGGCGAAGG + Intergenic
1049563531 8:143325345-143325367 ATGTGGTTATCAACTGCAGCAGG - Exonic
1050452038 9:5792122-5792144 ATGTGGCTATGCAGTGCAAAGGG + Intronic
1051340074 9:16102901-16102923 GGGTGGGTATGGACTGGGGAGGG - Intergenic
1051632318 9:19151632-19151654 ATGTGGTGATGGAATTCAGAAGG + Intergenic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052893296 9:33723409-33723431 GCGTGGGGATTGACTGCAGAGGG + Intergenic
1055917901 9:81425565-81425587 ACATGGGTATTGACTGTAGAGGG - Intergenic
1056446176 9:86668056-86668078 ATTTGGGGACAGACTGCAGAGGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1058552384 9:106128764-106128786 AGGTGGGTATTGAATGTAGAAGG - Intergenic
1059093659 9:111389258-111389280 ATGTGGATAGGGACTGTTGATGG - Intronic
1186335800 X:8586145-8586167 ATGAGGGCATAGACTGTAGATGG - Intronic
1187355283 X:18564116-18564138 ATGTGTCTCTGGACTTCAGAGGG + Intronic
1187501393 X:19842070-19842092 GAATGGGGATGGACTGCAGATGG + Intronic
1187572471 X:20518959-20518981 AAGAGGGGATGGACTGGAGAGGG + Intergenic
1190640736 X:52481427-52481449 CATTGGGTAGGGACTGCAGAGGG + Intergenic
1190646936 X:52531438-52531460 CATTGGGTAGGGACTGCAGAGGG - Intergenic
1193684642 X:84562255-84562277 ATATGCATATGAACTGCAGAAGG + Intergenic
1194710662 X:97232641-97232663 ATCAGGGTGTGGACGGCAGAAGG - Intronic
1195490464 X:105462908-105462930 ATGGGGGTAAGGACTGCAGATGG - Intronic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1199102585 X:143820952-143820974 ATGTGCTGATGCACTGCAGATGG + Intergenic
1201229757 Y:11852773-11852795 CTGTGGGAATGGACTGTTGAAGG - Intergenic