ID: 1120124191

View in Genome Browser
Species Human (GRCh38)
Location 14:80720925-80720947
Sequence CAGAGAAAACCTAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120124189_1120124191 6 Left 1120124189 14:80720896-80720918 CCAAATTCTCTACCACAATCTAT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG 0: 1
1: 0
2: 3
3: 22
4: 206
1120124190_1120124191 -6 Left 1120124190 14:80720908-80720930 CCACAATCTATACAACACAGAGA 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG 0: 1
1: 0
2: 3
3: 22
4: 206
1120124188_1120124191 10 Left 1120124188 14:80720892-80720914 CCATCCAAATTCTCTACCACAAT 0: 1
1: 0
2: 0
3: 20
4: 273
Right 1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG 0: 1
1: 0
2: 3
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120124191 Original CRISPR CAGAGAAAACCTAAGTATGA AGG Intronic
903724051 1:25427982-25428004 CAGAGAAAATCTGAGGGTGATGG - Intronic
905606854 1:39308639-39308661 AAAAGAAAACTGAAGTATGAAGG - Intronic
907004701 1:50899838-50899860 CAGAGAAAGCGTTAGTATTAGGG + Intronic
910163335 1:84297911-84297933 CAGAGAAAAGCTAAAGATGCAGG - Intergenic
914674054 1:149894350-149894372 CAGGGAAAGCCTAGGTGTGAAGG - Intronic
914978865 1:152394301-152394323 CAAAGAAAACCTAAGGACTAGGG - Intergenic
916266306 1:162892897-162892919 CATAGAAAATCGAAGTATGAAGG + Intergenic
917681938 1:177376299-177376321 CAGAGAAGACATAATTAAGATGG + Intergenic
918676861 1:187297265-187297287 CAAGGAAAACCTAAGTAGAACGG - Intergenic
920136023 1:203770025-203770047 CAGAGATCACCTAGGTAGGAAGG - Intronic
920755097 1:208721770-208721792 TAGAGAAAACCTAAAGCTGAAGG + Intergenic
920976006 1:210786019-210786041 AAGAGAGAAAATAAGTATGACGG - Intronic
921790079 1:219279763-219279785 CAGAGAAAACCAAAGTCAAAAGG + Intergenic
923239884 1:232073143-232073165 CAGAGAAAACCTAACACTGGAGG - Intergenic
923676560 1:236085511-236085533 CAGAGAAAACCTCACTGAGAAGG + Intergenic
923707277 1:236354282-236354304 CAGAGAAAATATCAGAATGAGGG + Intronic
1064291820 10:14041857-14041879 CAGAGAAAACTCAACTATGCTGG + Intronic
1067154609 10:43767378-43767400 CAAAAAAAACCTATGTATGCAGG + Intergenic
1068084373 10:52356496-52356518 CAGTGAAAACCCAATTATCAAGG - Intergenic
1068092267 10:52447354-52447376 CACAGAAAATCTATCTATGATGG - Intergenic
1068397542 10:56483806-56483828 CAGAGTAGTCCTAAATATGAGGG + Intergenic
1068564438 10:58557042-58557064 CAGAGAAAAAATAACTATCAAGG - Intronic
1068570937 10:58628329-58628351 CAGAAGTAACCTCAGTATGATGG - Intronic
1070258155 10:74827584-74827606 CAGAGCAAACTTAAATATGAAGG + Intronic
1072029147 10:91500568-91500590 CAGAGAAGTACTCAGTATGATGG + Exonic
1073974962 10:109090064-109090086 CACAAAATAACTAAGTATGAAGG - Intergenic
1077832059 11:5884255-5884277 CACTGAATTCCTAAGTATGAAGG - Exonic
1080218249 11:29870064-29870086 CAGAGAAAAGTTCAGTAAGAGGG + Intergenic
1081276116 11:41150890-41150912 CAGAGAAAACATACAGATGATGG + Intronic
1082202557 11:49390455-49390477 CAGAGAAAAACTCAGAATCAAGG - Intergenic
1083438297 11:62658516-62658538 CAGAGAGAACAAAACTATGAAGG + Intronic
1086652475 11:89309633-89309655 CAGAGAAAAACTCAGAATCAAGG + Intergenic
1086985942 11:93249305-93249327 CAGAGTAAACCACAGTATGTGGG - Intergenic
1089776224 11:120838130-120838152 CATAGAAATCATAAGAATGATGG + Intronic
1090056494 11:123429319-123429341 CAGAGAGCACCTAAATAGGATGG + Intergenic
1090592268 11:128284975-128284997 GAGAGAGAACCTAAGACTGAAGG - Intergenic
1095509063 12:42929459-42929481 CAGAGAAAATCTCAGTATGCAGG - Intergenic
1095790966 12:46166656-46166678 CAGAGAAAAGCTGAGTATGTGGG + Intergenic
1095927519 12:47593669-47593691 CTGAAAAGACCTAAGTCTGAAGG + Intergenic
1097580402 12:61448444-61448466 CAGAGAAACACTATTTATGATGG - Intergenic
1098533831 12:71572441-71572463 GAGAGAAAAACTAAATGTGAAGG - Intronic
1099460341 12:82913322-82913344 AAGCCAAAACCAAAGTATGATGG - Intronic
1104056268 12:125233217-125233239 CAGAGAAAACCAAAATAATAAGG + Intronic
1106201038 13:27537569-27537591 CAGAGAAACACTAAGTATGTTGG - Intergenic
1106446510 13:29837249-29837271 CACAGACAATCTAGGTATGACGG + Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1107040499 13:35942811-35942833 GTGAGAAACCCTAAGTGTGAAGG + Intronic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1110696864 13:78501292-78501314 CAGAATAAACCCAGGTATGAAGG + Intergenic
1111933842 13:94538849-94538871 CAGACAAATCCTAAGAGTGAGGG - Intergenic
1111995428 13:95161004-95161026 CAGAGAAAATCTAAATATGCGGG - Intronic
1112648192 13:101359662-101359684 CAAAGAAAACCTAAGAAAGAAGG - Intronic
1113167909 13:107463967-107463989 CAGAAAAGAGCTAAGAATGAAGG + Intronic
1114756650 14:25267538-25267560 CAGAGAAAAAAAAAGTATTAAGG - Intergenic
1117207931 14:53463745-53463767 CAGAGAAAGCCTAACTGTGAAGG - Intergenic
1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG + Intronic
1121048223 14:90803288-90803310 CAGCTAGAACATAAGTATGAGGG - Intronic
1121488658 14:94342053-94342075 CAGAGAAAACCACACTATGCAGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1125189569 15:36974981-36975003 CATAGAAAACCTTATTATCAAGG + Intronic
1127020875 15:54747215-54747237 CAGATAAAACCTATGTTAGAGGG + Intergenic
1130221662 15:82024653-82024675 CAGAGAAAACCGAAGTTCAAAGG - Intergenic
1130721246 15:86387423-86387445 AAACGAAAACCTAAGTCTGATGG - Intronic
1133600300 16:7333779-7333801 CAAAGAAAACCTTATGATGAGGG - Intronic
1133957886 16:10462275-10462297 AAGAGAAAACATAAATATGTGGG - Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1139637925 16:68270069-68270091 CAGAGAAATCCTAAAGCTGAGGG - Intronic
1144153371 17:12472872-12472894 CATAGAAGTCCTAAGTATTAAGG - Intergenic
1146246545 17:31288874-31288896 CAAAGAAAAGTTAAGAATGAGGG - Intronic
1149018513 17:51936384-51936406 GAGAGAAAACCTAGGTAGCATGG + Intronic
1150886164 17:69088582-69088604 CAGAGATAGCCCAAGTAGGAAGG - Intronic
1154390009 18:13928497-13928519 CAAAGAAAACTTAAAAATGACGG + Intergenic
1158260518 18:55601205-55601227 CTGGGAAAACCTAAATTTGAGGG + Intronic
1159972846 18:74675166-74675188 CAGAGAAAGCATAAGTATAAAGG - Intronic
1163426623 19:17244179-17244201 CAGAGACACCCAAAGTTTGAGGG + Intronic
1163794448 19:19328782-19328804 CCAGGAAAACCTAAGAATGATGG - Intronic
1164044921 19:21529015-21529037 CAAAGAAAACCTAAGGAAGAAGG - Intronic
1164102729 19:22072303-22072325 CAAATAAAACCTAAGAAAGAGGG - Intronic
1164113904 19:22197657-22197679 CAAAGGAAACCTAAGAAAGAAGG + Intergenic
1164198008 19:22989412-22989434 CAAAGGAAACCTAAGAAAGAAGG + Intronic
1164901688 19:31931751-31931773 CAGAGAAAAAGTAAGAATAATGG - Intergenic
927067121 2:19484142-19484164 CAAAGCAATCCTAAGTAAGAAGG - Intergenic
927436605 2:23071921-23071943 CAGTGAAGACCTAGGTATAATGG + Intergenic
928235085 2:29532262-29532284 CAAAGAAAATCTAAGAATGGAGG - Intronic
930178112 2:48320934-48320956 CAGAGATTGCCTAAGTATGTTGG + Intronic
931942880 2:67272542-67272564 CAGACAAACCCAGAGTATGAAGG + Intergenic
933259179 2:80112794-80112816 TAAAGAAAACATAATTATGAAGG + Intronic
933980655 2:87547827-87547849 AAGAGAAAACCTATGTCTGCAGG - Intergenic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
936029602 2:109060479-109060501 GAGAGAAAAGGCAAGTATGATGG - Intergenic
936313172 2:111402964-111402986 AAGAGAAAACCTATGTCTGCAGG + Intergenic
937626301 2:124047650-124047672 CAGAGAAAACCTAGATAACATGG - Intronic
940099468 2:150017490-150017512 CAAAGAAAATTTAAGTATGAAGG - Intergenic
941164381 2:162069804-162069826 AAGAGAAAACCCAAATGTGAAGG - Intronic
941286240 2:163616516-163616538 CTGAGAAAACCTACAAATGAAGG - Intronic
942062989 2:172245045-172245067 CAGAGCAAACCTCAGTGTGCTGG + Intergenic
942364101 2:175204592-175204614 CAGAGGGAGCCAAAGTATGATGG + Intergenic
944484264 2:200187969-200187991 AAGAGAAAAACAAAGTTTGAAGG + Intergenic
947595752 2:231410594-231410616 CAGAGAGAACCTGAGTCTGTGGG - Intergenic
1169290078 20:4342019-4342041 CAGAGAAAACCACAGATTGACGG - Intergenic
1170352860 20:15460870-15460892 TAGAGAAAACCTAAGTGTGATGG + Intronic
1171568888 20:26226429-26226451 CAGAGAAAACCTACTCAAGAAGG - Intergenic
1171944221 20:31361674-31361696 GAAAGAAAACATAACTATGAGGG + Intergenic
1177091484 21:16774625-16774647 CAGAGAAAACGTAATAAAGAGGG - Intergenic
1177558478 21:22720314-22720336 TAGAGAAAAACTAAATCTGAGGG - Intergenic
1177748452 21:25250770-25250792 CAGAGAAAACCTCAGGATGAAGG - Intergenic
1177967778 21:27749865-27749887 CAAAGAAAATTTAAGTAGGAAGG + Intergenic
1180282039 22:10709218-10709240 CAGAGAAAACCTACTCAAGAAGG + Intergenic
1181456521 22:23063133-23063155 CTGAGCAGACCTAAGAATGATGG + Intronic
1181546983 22:23607686-23607708 CTGTGCAAACCTAAGAATGATGG - Intergenic
1203239282 22_KI270732v1_random:40376-40398 CAGAGAAAACCTACTCAAGAAGG + Intergenic
949123074 3:411438-411460 AAGAGAAAGCTCAAGTATGAAGG - Intergenic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
951228421 3:20147990-20148012 AAGAGAAAAGGTAAGTATGACGG + Exonic
954130508 3:48558375-48558397 CAGAGAGAACCTGAGGATGCAGG - Intronic
955034960 3:55258621-55258643 CAGTAAAAACCTATGTATGTAGG - Intergenic
955468842 3:59264927-59264949 CAAAGAAAACCTAGGCATTATGG - Intergenic
957016949 3:75077305-75077327 CAGAGAAGGCCTAAGTAGAAGGG - Intergenic
957109963 3:75941923-75941945 CAGAGAAAACCTACTCAAGAAGG + Intronic
957115448 3:76018803-76018825 CAGAGAAAAACTAACCATGTTGG - Intronic
957115458 3:76018893-76018915 CAGAGAAAACCGAACCATGTGGG - Intronic
957115478 3:76019073-76019095 CAGAGAAAACCAAACCATGTGGG - Intronic
957115486 3:76019163-76019185 CAGAGAAAACCTAACCATGTGGG - Intronic
957115493 3:76019253-76019275 CAGAGAAAACTTAACCATGTAGG - Intronic
957115503 3:76019343-76019365 CAGAGAAAACCGAACCATGTGGG - Intronic
957115512 3:76019433-76019455 CAGAGAAAACCAAAGCATGTGGG - Intronic
957115538 3:76019703-76019725 CAGAGAAAACCTAACCATGTTGG - Intronic
957115546 3:76019793-76019815 CAGAGAAAACCTAAACATGTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957321938 3:78642580-78642602 CAGAGAAAACCTGAGAAGGGTGG - Intronic
957585023 3:82122032-82122054 CTGAGAAAAGCTGAGTAGGAAGG - Intergenic
958216624 3:90589794-90589816 CAGAGAAAAACAAGATATGATGG - Intergenic
958492050 3:94788325-94788347 CAAAGAGCACCTAAGAATGAAGG + Intergenic
963591105 3:147260721-147260743 CAGAGAAATACTTAATATGAGGG + Intergenic
966028813 3:175320297-175320319 CACACAATACATAAGTATGATGG - Intronic
966604684 3:181810420-181810442 CAGACAAATCCTGAATATGAGGG - Intergenic
966733736 3:183172275-183172297 CAGAGAAGACCTAAAGTTGAAGG - Intergenic
967559397 3:190900908-190900930 GGGAAAAAACCTATGTATGAAGG - Intergenic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
971106523 4:23530852-23530874 CAGAGAAAGTCTGAGTATGGAGG - Intergenic
974972545 4:68847247-68847269 GAGAGAAAAACTAAGAATAAAGG - Intergenic
976929083 4:90541360-90541382 CAGAGAAAAGCTGACTTTGAAGG - Intronic
977129101 4:93211573-93211595 AGTAGAAAACCTAAGTTTGAAGG - Intronic
977156970 4:93586260-93586282 CAGATAAGTCCTGAGTATGAGGG - Intronic
979266444 4:118708712-118708734 AAGAAATAACCTAAGGATGATGG + Intronic
979454865 4:120915845-120915867 CAGAGAAACCCTACATAAGAGGG + Intronic
979528512 4:121742821-121742843 CAGACAAAACCAGAGGATGAGGG - Intergenic
984377495 4:178951696-178951718 CTGAAAAAACCTAAGTATTTAGG + Intergenic
985871458 5:2560678-2560700 CAGAGCAAACCTAAGTGTTTAGG + Intergenic
988661193 5:33270456-33270478 CAGATAATACACAAGTATGAGGG + Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989543817 5:42648821-42648843 CAGAAAAAACCTAAATCTGCAGG - Intronic
989953338 5:50327412-50327434 CAGAGAGAACTTAAGTAGAAAGG - Intergenic
989954626 5:50342987-50343009 CAAAGAAAGACTAAGTATTAGGG + Intergenic
991180148 5:63741360-63741382 CAGAGAAAACATCCATATGATGG + Intergenic
992971098 5:82058921-82058943 AAGAGAAACCAAAAGTATGACGG - Intronic
993252261 5:85543715-85543737 CAGAGAAATCCTAAGTATAAAGG + Intergenic
993568838 5:89510586-89510608 CAGAGGAAGGCTAAGTATGGTGG - Intergenic
994608451 5:102002996-102003018 CAGAGATAAAATAAGTAGGATGG - Intergenic
1000197102 5:158970330-158970352 TAAAGAAAACCTAATTAAGAAGG - Intronic
1001070022 5:168577840-168577862 CAGAGAAAACGTATGCGTGAGGG + Intronic
1001257020 5:170191783-170191805 CTGAGGAAGCCTAATTATGAAGG + Intergenic
1003607048 6:7571790-7571812 CAGAGAATACCTAGGTATCAAGG - Intronic
1005391412 6:25337616-25337638 TAGAGAAAACACAAGTGTGAAGG + Intronic
1005883114 6:30075082-30075104 GAGAGAAAAGCAAAGGATGAGGG - Intronic
1006176206 6:32123349-32123371 CAAAAAATACCTAAGTATGGAGG + Intronic
1008438548 6:51505199-51505221 CAGAGGAAACCTTAGTGTGATGG - Intergenic
1009852788 6:69218492-69218514 GAAAGAAAACCTAATTATTAGGG + Intronic
1009985081 6:70772126-70772148 CATAGAAAACCCAAGTAGGTAGG + Intronic
1010744505 6:79545797-79545819 AAGAGAAAAGCTAAGCCTGATGG + Intergenic
1012392376 6:98757131-98757153 AGCAGAAAACCTATGTATGATGG - Intergenic
1014705944 6:124747499-124747521 CAGAGAACAGCTTAGTGTGAAGG + Intronic
1015683517 6:135834206-135834228 TAAAGAAAACCTAAGGAGGACGG - Intergenic
1016459241 6:144264617-144264639 CAGAGAAAAGCTTAGTTTTAGGG + Intergenic
1017386299 6:153888387-153888409 CATAGAAACCATAATTATGATGG - Intergenic
1018863277 6:167728053-167728075 CAAAGAAAAACTAAATAAGAAGG + Intergenic
1020916981 7:14206950-14206972 TGAAGAAAACCTAAGTATTAGGG + Intronic
1021080410 7:16357775-16357797 CAGAGATACCCGAAGTCTGAGGG + Intronic
1021830881 7:24608350-24608372 CACAGAAAACTTTAGAATGAAGG - Intronic
1023536070 7:41212550-41212572 CAGAAAAAACTTATGTATAATGG - Intergenic
1023701356 7:42894149-42894171 CAGAGGAAACCCAAGTGAGAAGG + Intergenic
1023722278 7:43108891-43108913 CAGAGAAATGCTAAGTTTGTGGG + Intergenic
1024504191 7:50147382-50147404 CAGAGAAAGTCTAAGTATCATGG - Intronic
1025816453 7:64916961-64916983 CAAAGGAAACCTAAGAAAGAAGG - Intronic
1025866550 7:65387304-65387326 CAAAGAAAACCTAATAAAGAAGG - Intronic
1026178614 7:68019247-68019269 CAGAGAAGACATAAGTAGCATGG + Intergenic
1027241661 7:76334090-76334112 CAGTGAAAAACTAAGTTAGAGGG + Intronic
1029975822 7:104832314-104832336 AAGAAAACACCTAACTATGAAGG + Intronic
1030138548 7:106283774-106283796 CAGACAAAACTTAAGTAAAATGG + Intronic
1031154089 7:118088406-118088428 CAGAAAAAAGCAAAGGATGATGG - Intergenic
1031323998 7:120368930-120368952 CACAGAAAACCTAATCTTGAAGG - Intronic
1031469150 7:122148182-122148204 GAGAGAAAACCAAAGTAGGTGGG - Intergenic
1031592294 7:123608581-123608603 AAGAGAAATCCTAAGCATGATGG - Exonic
1033329278 7:140404648-140404670 TAGAGAAAACCAAAGTAAAACGG + Intronic
1034670729 7:152856269-152856291 CAGAGAAACACTACGGATGAGGG - Intergenic
1039943685 8:42112265-42112287 CTGAGAAAACCTAAATTTCATGG - Intergenic
1042444909 8:68872423-68872445 GAGAGAAATTCAAAGTATGATGG + Intergenic
1042510874 8:69609508-69609530 CAGAGAATATCAAAGTTTGAAGG + Intronic
1044574297 8:93751638-93751660 CAGAGAAAACCTCAAAATCAGGG + Intergenic
1044697303 8:94936231-94936253 CAGAGAAACACTAATTAGGAGGG + Intronic
1045835901 8:106521453-106521475 CAGAGAAAGCCTGATTCTGACGG - Intronic
1046170811 8:110502647-110502669 CAGAGAAAACCCAAATACAAAGG - Intergenic
1047988779 8:130264047-130264069 CAGAGGATTCCTAAATATGATGG + Intronic
1048774591 8:137931927-137931949 CAGAGGAAAACTGAGTATCATGG - Intergenic
1051580669 9:18670373-18670395 CAGAGGTAACCTAAGCAGGATGG + Intronic
1052416070 9:28180027-28180049 GACAGAAAATATAAGTATGAAGG - Intronic
1055503578 9:76925965-76925987 CAAAGATAACCTAAGTTTTATGG - Intergenic
1056254252 9:84782444-84782466 CACAGCAAAGCTAGGTATGACGG - Intronic
1056751620 9:89355861-89355883 CAGAAAAAACCGGAGTTTGATGG - Intronic
1057000820 9:91507345-91507367 CAAAGAAAACCTATTTATTAAGG + Intergenic
1057082538 9:92183788-92183810 CTGAGAAAACCTATGTTTGGGGG - Intergenic
1058946339 9:109860440-109860462 CAGATAAAACCTAGGTATCCTGG + Intronic
1062706455 9:137946726-137946748 CAGAGAGCACCTAAGCATGGAGG - Intronic
1186536507 X:10355607-10355629 CAGAGGAGGCCTCAGTATGAAGG + Intergenic
1187792060 X:22961712-22961734 CAGAAAAAATCTCAGTATAAAGG - Intergenic
1188012823 X:25075654-25075676 AAAAAAAAACCAAAGTATGAAGG - Intergenic
1188920444 X:35969894-35969916 GAAAAAAAACATAAGTATGAAGG - Intronic
1191191878 X:57676560-57676582 CAGTGAGCACCCAAGTATGAAGG + Intergenic
1192616273 X:72625987-72626009 CAAAGAAAACTTAAGTATTTAGG + Intronic
1193591899 X:83398910-83398932 CAGAGCAGAACTAAGTAAGATGG + Intergenic
1195158256 X:102143776-102143798 CAGAGCACACCTATGCATGATGG - Intergenic
1195396848 X:104420084-104420106 CAGATAAGACCTAAATAGGAGGG - Intergenic
1195468537 X:105208566-105208588 CAGAGAAAAGCTAAGTGAGAGGG + Intronic
1196374324 X:115015767-115015789 TAGAGATAACCTAAGTATCCGGG + Exonic
1197458667 X:126710530-126710552 CAGTGAAAACATAAGAATTAGGG + Intergenic
1199205183 X:145140282-145140304 CAGAGAAAGCCTAAGATTGCTGG + Intergenic
1200176284 X:154118755-154118777 GATTGAAAACCTAAATATGAAGG - Intergenic
1202073225 Y:21014237-21014259 GAGAGAAAACCTGAATAGGAAGG + Intergenic
1202077925 Y:21056091-21056113 GAGAGAAAACCTGAATAGGAAGG + Intergenic
1202587010 Y:26441485-26441507 AAGAGAAAACCTAAGTGGGTAGG - Intergenic