ID: 1120128770

View in Genome Browser
Species Human (GRCh38)
Location 14:80780414-80780436
Sequence TTGGTTTCACAGGAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120128768_1120128770 -6 Left 1120128768 14:80780397-80780419 CCTTAAGGGTAAATTGTTTGGTT 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1120128770 14:80780414-80780436 TTGGTTTCACAGGAAACTGCTGG 0: 1
1: 0
2: 4
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120128770 Original CRISPR TTGGTTTCACAGGAAACTGC TGG Intronic
901779135 1:11581298-11581320 TTGTGCTCCCAGGAAACTGCAGG + Intergenic
902073414 1:13762450-13762472 TTGGAGACACAGGAACCTGCTGG + Intronic
903562011 1:24235343-24235365 TTGGCTTCACAGGAGACAGCTGG + Intergenic
904798167 1:33073047-33073069 ATGGTTTCAGAGGATACAGCTGG - Intronic
912455397 1:109793337-109793359 ATAGTTGCGCAGGAAACTGCTGG - Intergenic
912657144 1:111497088-111497110 TTAGTGTCACAGGAATCTCCTGG - Intronic
914510210 1:148325566-148325588 TTACTTTCAAAGTAAACTGCAGG + Intergenic
916123929 1:161552507-161552529 TGGGTCTCACAGGAATCTGGAGG + Intergenic
918551929 1:185752706-185752728 TTGCTTACACAGAAAACTGTAGG + Intronic
920849492 1:209618925-209618947 CTGGTGCCACAGGAAGCTGCGGG + Intronic
1063170122 10:3501662-3501684 TTGATTTCCCTGGAAACTGAAGG - Intergenic
1063511975 10:6654542-6654564 TGGGTTATACAAGAAACTGCGGG + Intergenic
1063511978 10:6654565-6654587 TGGGTTATACAAGAAACTGCAGG + Intergenic
1066503471 10:36017592-36017614 TTTGTTTCCCAGGAAGCTTCAGG - Intergenic
1068944002 10:62710179-62710201 CTTGTTTCAGAGGAAACTGAAGG + Intergenic
1069349920 10:67513120-67513142 TGGGTTTCATATCAAACTGCAGG - Intronic
1069981689 10:72257111-72257133 GTGGTTTGAAAGGAAACAGCAGG + Intergenic
1071224999 10:83518971-83518993 GTGATCTTACAGGAAACTGCTGG - Intergenic
1073404864 10:103288348-103288370 TTGAATTTACAGGAAACTGCTGG + Exonic
1073463294 10:103678804-103678826 TTTGTCTCCCAGGAAACGGCTGG + Intronic
1074060526 10:109961542-109961564 TTTGTTGCCCAGGAAACTGGTGG + Intergenic
1074590674 10:114809991-114810013 TTGAGTGCACAGGAAACTGATGG + Intergenic
1075032300 10:119031687-119031709 TTTGTTTGACAGGCAACAGCTGG - Exonic
1076331345 10:129672091-129672113 TTCATTTCACAGGGAATTGCTGG + Intronic
1084468341 11:69340454-69340476 ATGGCTTCAAAGGAAACTTCTGG + Intronic
1084726295 11:70944420-70944442 CTGCTTTCTCAGGAAGCTGCTGG - Intronic
1085078371 11:73612357-73612379 CTAGTTTTACAAGAAACTGCCGG + Intergenic
1085667850 11:78431462-78431484 TTGGTTTCTCTGGAAGCTGAGGG + Intergenic
1087973729 11:104517798-104517820 TTGGTTTGAAAGGACTCTGCAGG + Intergenic
1089328258 11:117672212-117672234 TTGCTTCCACAGTAACCTGCTGG - Intronic
1089598917 11:119601130-119601152 TGACTTTCAAAGGAAACTGCAGG + Intergenic
1089995441 11:122902616-122902638 TTGGTTTCTAAGGAAACCTCGGG + Intronic
1090339686 11:126006042-126006064 TTTGTTTCAAAAGGAACTGCAGG + Exonic
1091061807 11:132470448-132470470 TAAGGTTCACAGGAAAATGCAGG + Intronic
1092442693 12:8522057-8522079 TTGGTATCACAGGAAGTTACTGG + Exonic
1093555963 12:20474582-20474604 TTGCTTTCTCAGGAGACTCCAGG + Intronic
1094473723 12:30825499-30825521 GTGGTTGGACAGGACACTGCTGG + Intergenic
1097073848 12:56377402-56377424 TAGGTTTCACAGGATGCAGCAGG + Intergenic
1099860421 12:88218761-88218783 TTGGTTTCACAGGGCATTGGCGG - Intergenic
1099976560 12:89551699-89551721 TTCATTTCAAAGGAAACTGGAGG - Intergenic
1100379415 12:94047804-94047826 TTGGTTTCTGAGAAAGCTGCAGG - Intergenic
1101340485 12:103838518-103838540 TTAGTTTTATAAGAAACTGCAGG - Intronic
1107494422 13:40911022-40911044 TTTGTTTCCCAGGAAACTTTAGG - Intergenic
1107910870 13:45104811-45104833 ATAGTTTCACAGGAAATTGGGGG + Intergenic
1108963548 13:56267559-56267581 TTAGGTTCACAGGAAACTTGAGG - Intergenic
1110299101 13:73904744-73904766 TTGGTTTAGCAGGAAAGTGATGG + Intronic
1111473255 13:88713832-88713854 TTGGTTTCATAGGAAAGCTCTGG + Intergenic
1111626241 13:90791251-90791273 TTTGTTTCACAGTAAAATGCAGG + Intergenic
1112261006 13:97878478-97878500 TTGGTATCCCAGGCAACTGTGGG - Intergenic
1117288143 14:54307264-54307286 CTGGTTTTACAGGAAGCAGCTGG - Intergenic
1117409328 14:55436649-55436671 TTGGTTTCTCAGGAGAGGGCTGG + Exonic
1119656369 14:76420116-76420138 CTGGTTTCACAGGTAACTCAAGG - Intronic
1119696801 14:76719758-76719780 TTGGTTCCACAGGTCACTCCTGG - Intergenic
1120128770 14:80780414-80780436 TTGGTTTCACAGGAAACTGCTGG + Intronic
1124019327 15:25904897-25904919 CTGGGTACCCAGGAAACTGCAGG - Intergenic
1129595578 15:76961376-76961398 CTGCCTTCACAGGAAGCTGCAGG + Intergenic
1137367621 16:47874280-47874302 GTGGTTTCATAGGAAATGGCAGG - Intergenic
1137449155 16:48554815-48554837 TTAGTTTCACTGGAATTTGCAGG - Intronic
1137792004 16:51183064-51183086 TTGGTTTTACATTAAAATGCTGG - Intergenic
1138315641 16:56067592-56067614 TTGGTTTCTATGGAAACTGGAGG + Intergenic
1138896917 16:61217607-61217629 TGGGTTTCTCAAAAAACTGCAGG + Intergenic
1143043115 17:4054390-4054412 GTGCTTTCACAGGAAATTGCAGG + Intronic
1143165955 17:4897395-4897417 TTGATTTCACTGGAGCCTGCTGG + Exonic
1148804698 17:50258242-50258264 AGGGTTCCACAGGCAACTGCTGG + Intergenic
1148961246 17:51395000-51395022 TTTGATTTACAGGAAACTTCTGG + Intergenic
1151141739 17:71999758-71999780 CTGGTTTCACATCAAACTCCAGG + Intergenic
1151402339 17:73864093-73864115 TTGTTTTCATCGGAAAATGCTGG - Intergenic
1153141767 18:1980798-1980820 TTGGTTTCATAGGAAGTTGAAGG - Intergenic
1153588077 18:6644572-6644594 TTGGTTTCACAGGATACTGATGG - Intergenic
1157371214 18:47113957-47113979 TTGGTTACCCAGGAAAGTGGTGG - Intronic
1157632715 18:49114923-49114945 ATGGTTTCATAGGCAACTGTGGG + Intronic
1157831766 18:50862577-50862599 CTGCTTTCACAGGAGTCTGCAGG + Intergenic
1161373444 19:3926730-3926752 GTGGCTCCACAGGAACCTGCAGG - Exonic
1161932241 19:7348862-7348884 TTGGTTCCACAGGAAGCTGCTGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162621075 19:11844808-11844830 TTTGCTTCATAGGCAACTGCTGG + Intergenic
1162635051 19:11961551-11961573 TTTGCTTCACAGGAAACTGCTGG + Intronic
1163689245 19:18729894-18729916 CTGGTTTCACAGGCAACCCCAGG - Intronic
1165595745 19:37010112-37010134 CTGGTTTCTCAGGCAACTGTGGG - Intronic
925836510 2:7951863-7951885 TTAATTTCAGAGAAAACTGCAGG + Intergenic
927403759 2:22744357-22744379 TTGGTTGCTAAGGAAGCTGCAGG + Intergenic
927572790 2:24174949-24174971 TTGATTTCACAGCAAACGGGCGG - Intronic
929465284 2:42138324-42138346 CCCTTTTCACAGGAAACTGCAGG + Intergenic
929841817 2:45474531-45474553 TTGGATTCACAGTATACTGGAGG + Intronic
931087205 2:58845875-58845897 TTGGTTTCACAGAGAAAAGCTGG - Intergenic
931349979 2:61478956-61478978 CTGTTTTCACAGGAATTTGCAGG - Exonic
931994005 2:67822687-67822709 TTGTTTACACAGGGAACTCCAGG - Intergenic
932074871 2:68653495-68653517 TTGGTTTCAAAGGAAACAACCGG + Intronic
932132176 2:69197595-69197617 TTGTATTTACAGGAAACTGTGGG - Intronic
935802105 2:106708059-106708081 TAGGTTGGACAGGAAGCTGCTGG + Intergenic
936115946 2:109703184-109703206 TTGGCTGGACAGGAAACTGCTGG + Intergenic
941595726 2:167474660-167474682 TTGGTGTCAGAGATAACTGCAGG - Intergenic
946648137 2:221862113-221862135 TTGGTCAAAAAGGAAACTGCAGG - Intergenic
946754358 2:222928894-222928916 TTGATTTCACAGCAAACTAATGG - Exonic
947681526 2:232037939-232037961 TTGGTCTCACTGGGAGCTGCAGG + Intronic
948188199 2:236037910-236037932 ATGGTTACAAATGAAACTGCAGG - Intronic
1168895581 20:1321263-1321285 CTGGTGGCACAGGAAACTGAGGG + Intronic
1168965719 20:1896728-1896750 TGGGTTTCAGGGGAAACTGCAGG - Intronic
1169424095 20:5483149-5483171 TTTATTTCACAGGAAACAGCAGG - Intergenic
1171231750 20:23492505-23492527 GAGGTTTCACAGGAATCTGAGGG + Intronic
1171405123 20:24907101-24907123 TTAGTTTTATAAGAAACTGCCGG - Intergenic
1172032726 20:31993138-31993160 TGGCTTTCCCAGGAAACTGGGGG - Intronic
1172956754 20:38765468-38765490 TTGTTTTCAGAGGAAACACCTGG + Exonic
1174675334 20:52348656-52348678 TTGCTTTGACAGGCAACTACAGG + Intergenic
1178627995 21:34234176-34234198 TTGATTTAACGGGAAACTTCTGG + Intergenic
1179260255 21:39751424-39751446 TGGGTTTCCCAGGAAAGTTCTGG + Intronic
1179441862 21:41400412-41400434 TTGGTTTGACAAGAGCCTGCTGG + Intronic
1182398207 22:30052721-30052743 TTGGCTTTATAAGAAACTGCTGG + Intergenic
1183514398 22:38255472-38255494 TTAGTTTTATAAGAAACTGCCGG - Intronic
1185248204 22:49784748-49784770 TTGGTTTCACCGGAACCTTCTGG - Intronic
949387107 3:3515160-3515182 TTGATGTCATAGGAAAATGCAGG + Intergenic
950970925 3:17187065-17187087 TCGTTATCACAGGAAACTGTAGG + Intronic
952665582 3:35900271-35900293 TTGGCTTCTCAAGAAACAGCAGG + Intergenic
953894867 3:46789137-46789159 TTAGTTTTATAAGAAACTGCTGG - Intronic
954946492 3:54429501-54429523 CTGTTTTCACAGGAGAATGCTGG + Intronic
955198798 3:56830781-56830803 TTGGTGGCAGAGGAAACAGCCGG - Intronic
956334694 3:68150209-68150231 TTTGTATCTTAGGAAACTGCAGG - Intronic
957098361 3:75799108-75799130 TTGATCTCACTGGAAGCTGCAGG + Intergenic
959092051 3:101913454-101913476 TTGGTTAAAAAGGCAACTGCAGG - Intergenic
962194389 3:133348420-133348442 TTGGTTTCTCAGGAAACCTTGGG + Intronic
962339283 3:134568438-134568460 TGGGTTACACAGGAACCTGCAGG - Intronic
965323291 3:167272924-167272946 TTGGTTACACTGGCAACTGGGGG - Intronic
969175332 4:5394550-5394572 TCTCTTTCACAGGAGACTGCTGG - Intronic
972177751 4:36428260-36428282 TTGTTTTCCCAGGAAACACCCGG + Intergenic
972327776 4:38034056-38034078 TTAGTTTTACAAGAAACTGCTGG + Intronic
972349698 4:38225349-38225371 TTGGGTTCACAGGTCACAGCTGG - Intergenic
973710660 4:53627142-53627164 TTGGTCTCACAGGATAATGGTGG + Intronic
974221553 4:58979545-58979567 TTTGTTCCACAGAAAACTGTAGG - Intergenic
974733150 4:65896435-65896457 TTGGTTTCTGGGGAAACTTCAGG + Intergenic
974806378 4:66885635-66885657 TGGGTTTTACATGAAATTGCTGG + Intergenic
978069589 4:104451027-104451049 TTGGTTCCAAAGGGAACTTCAGG + Intergenic
979043369 4:115829994-115830016 TTGGTTTCAAAAGAAACAGTAGG + Intergenic
979608203 4:122661783-122661805 TTGTTTTCAAAGGAACCAGCAGG + Intergenic
979854873 4:125619334-125619356 TGGGTTTCAAATGAAATTGCTGG + Intergenic
980161885 4:129174402-129174424 TTGCTTTACCAAGAAACTGCAGG + Intergenic
980783455 4:137521498-137521520 TTCTTTTCACCGGAATCTGCAGG + Exonic
981690741 4:147505946-147505968 TTAGTTTTATAAGAAACTGCCGG - Intronic
981735561 4:147946491-147946513 ATGTTTTCCTAGGAAACTGCAGG + Intronic
984112995 4:175643432-175643454 CTGGTTTCTCAGGAAACAACAGG - Intronic
984627035 4:182019235-182019257 TTCGGTTCACAGGAAACTTTGGG - Intergenic
985469858 5:33491-33513 TTGATTTGACAGGAACCTGGAGG - Intergenic
985731804 5:1553663-1553685 TGGGCTGCAGAGGAAACTGCAGG - Intergenic
989948998 5:50274822-50274844 TTGGTTACATAAAAAACTGCTGG + Intergenic
995730122 5:115229876-115229898 ATGGCTTCAGAGGAAACTCCAGG + Intronic
995737186 5:115313894-115313916 CTGGTTTCACTAGAAATTGCAGG - Intergenic
995921572 5:117320397-117320419 TAGGTTTCAAAGGAAACTTTTGG + Intergenic
996416679 5:123218020-123218042 TCTGTTTCAGAGGAAACTTCGGG + Intergenic
997113131 5:131097056-131097078 TGGGTTTCTCAAGAAACTGTTGG - Intergenic
997782847 5:136677288-136677310 TTGGTCTCATAAGAAGCTGCCGG - Intergenic
997918953 5:137958880-137958902 TGGATTTCAGAGTAAACTGCAGG + Intronic
998583986 5:143405958-143405980 TTTGTTTCCCATGAAACTGTTGG - Intronic
998899167 5:146833877-146833899 TTGTTTTCACATAACACTGCAGG + Intronic
999563423 5:152830246-152830268 TTGGCATCTCAGGAAACTGTGGG - Intergenic
1003784028 6:9463355-9463377 TAGGTTTCTCAGGACACTCCTGG - Intergenic
1010974036 6:82293062-82293084 TTAATTTCTCAGGTAACTGCAGG + Intergenic
1011968150 6:93186267-93186289 TTGGTATAACAGAAAACTGTAGG - Intergenic
1013759153 6:113496294-113496316 TTTGTCTCACAGGAAACATCTGG + Intergenic
1019126233 6:169841932-169841954 TTCCTTTCACAAGAGACTGCAGG + Intergenic
1020781995 7:12529653-12529675 TTGGTTTCACCTGGAAATGCAGG + Intergenic
1026601136 7:71778095-71778117 TTTGTTATACAGGAAACTCCTGG + Intergenic
1030255576 7:107506309-107506331 TTGGTTTCTCAGGAATGGGCAGG + Intronic
1032343797 7:131100852-131100874 TTGGTTTCAAGGGCAACAGCAGG + Intergenic
1037967333 8:23145030-23145052 TTGGTTTCTCCAGAAACTGGGGG - Intronic
1039269710 8:35867676-35867698 TTTATTCCACAGGAACCTGCAGG + Intergenic
1043570351 8:81595754-81595776 TTGTTTACACAGGAAAAAGCAGG + Intergenic
1044545058 8:93449921-93449943 TTGGCTTCCCAGGAAACTGCAGG + Intergenic
1046009685 8:108531238-108531260 TTGGTTTCATAGCATAATGCAGG + Intergenic
1046628193 8:116597720-116597742 TTGTTTTCAGAGGAAATGGCAGG + Intergenic
1047728890 8:127709421-127709443 ATGGTTTCAAAAAAAACTGCAGG + Intergenic
1051531469 9:18108881-18108903 ATGCTTTCACAGGTAACTGCTGG - Intergenic
1053501780 9:38602730-38602752 TTGCTATCACAGCTAACTGCAGG + Intergenic
1054784057 9:69193539-69193561 TTGGTGACACGGGAAACTTCAGG - Intronic
1054894389 9:70291758-70291780 AAGTTTTCCCAGGAAACTGCCGG + Intronic
1056876920 9:90342366-90342388 TTGGTTTCCCAGGAAACAGATGG - Intergenic
1057231935 9:93326364-93326386 TTGGTTCCTCAGTAAACTGGAGG + Intronic
1058265988 9:102899305-102899327 TTGGTTTCACATGAAATTCTGGG - Intergenic
1060669197 9:125453394-125453416 TTGGTTGAACAGAAAACAGCTGG + Intronic
1186135796 X:6519117-6519139 TTGGTTTCACAGTAAAATTGAGG + Intergenic
1187579788 X:20595409-20595431 TTGGTTCCATAGGGAACTTCAGG + Intergenic
1189207196 X:39251958-39251980 TTAGTTTCACATAAAAGTGCAGG - Intergenic
1189856270 X:45228466-45228488 TTGGAGACACTGGAAACTGCAGG + Intergenic
1190485166 X:50916628-50916650 CAGGTTTCCCAGGAAACTGGAGG + Intergenic
1191777017 X:64825558-64825580 TTGGTTTCAGAAGGAACTGTGGG + Intergenic
1193132962 X:77937393-77937415 TTAATTTCATAAGAAACTGCTGG - Intronic
1195911713 X:109895292-109895314 TTGGTATCACAGGAAGTTACTGG + Intergenic
1196988842 X:121305325-121305347 TTAGTCTAACAGGAAAATGCAGG - Intergenic
1197319010 X:125005619-125005641 TTGGTCTCACTGGGAGCTGCTGG - Intergenic
1199501918 X:148516470-148516492 ATGGTTTCACAGGAAGCATCAGG - Intronic
1199684272 X:150252448-150252470 TTGGCTTCATAGAAAACAGCTGG + Intergenic