ID: 1120129294

View in Genome Browser
Species Human (GRCh38)
Location 14:80786192-80786214
Sequence CTCTCTAAGATTTACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129289_1120129294 4 Left 1120129289 14:80786165-80786187 CCTAGAAGTCCATCATTCTATGC 0: 1
1: 0
2: 0
3: 14
4: 115
Right 1120129294 14:80786192-80786214 CTCTCTAAGATTTACATGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 147
1120129290_1120129294 -5 Left 1120129290 14:80786174-80786196 CCATCATTCTATGCCAGCCTCTC 0: 1
1: 0
2: 2
3: 29
4: 301
Right 1120129294 14:80786192-80786214 CTCTCTAAGATTTACATGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129294 Original CRISPR CTCTCTAAGATTTACATGGA AGG Intronic
908001634 1:59686024-59686046 TTCTATAAGAGTTCCATGGAAGG - Intronic
908007254 1:59739643-59739665 CTCTCTAAAATGTACGTGGAAGG + Intronic
908371111 1:63478466-63478488 TTATTTCAGATTTACATGGATGG - Intronic
914233416 1:145786269-145786291 TTATCTAATATTTACATGCAAGG + Intronic
914726790 1:150334620-150334642 CTCTATAAGAGTTATTTGGATGG - Intronic
918091119 1:181295947-181295969 GTCTCTAAGAGTTACTTGGAAGG + Intergenic
921503310 1:215933895-215933917 CCCTCTAGGGTTGACATGGATGG - Intronic
923717795 1:236440362-236440384 GATTCTAAAATTTACATGGAGGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063638383 10:7807099-7807121 CTCTGAGAGATTTAGATGGATGG + Intronic
1066176167 10:32909034-32909056 ACTTCTAAAATTTACATGGAAGG + Intronic
1068420519 10:56785634-56785656 CTGTCTAATTATTACATGGAAGG - Intergenic
1068670669 10:59719531-59719553 CTTTCCAAGAATTACATCGAAGG - Intronic
1069183771 10:65396543-65396565 CTCTCTATGTTCTTCATGGATGG + Intergenic
1070052972 10:72906904-72906926 GTCTCTAAGATTTAACAGGAGGG + Intronic
1071668887 10:87588770-87588792 CTCTCTAGGATGCAAATGGAAGG - Intergenic
1073868393 10:107831740-107831762 AGCACTATGATTTACATGGAAGG + Intergenic
1074390718 10:113055895-113055917 CTCTCTAACAGTCACATTGAAGG + Intronic
1075264886 10:120991608-120991630 CTCTGTAAGATTTTGATGCATGG + Intergenic
1079774071 11:24501164-24501186 CTCTATCTCATTTACATGGAAGG - Intronic
1080655963 11:34258397-34258419 CTGTCAAAGATTTACAGAGATGG + Intronic
1082654339 11:55834833-55834855 ATCACTAAGATTTACATGCTGGG + Intergenic
1082843887 11:57711917-57711939 CTCTCTAAGATTTGATTGGCTGG + Intronic
1083258857 11:61512476-61512498 GTGTCTAAGATTTGCATGAAAGG - Intergenic
1085883023 11:80489883-80489905 GACTGTAAGATTTACAAGGAGGG + Intergenic
1088818698 11:113438691-113438713 TTCTCAAAGATTTAGAGGGAAGG - Intronic
1092462605 12:8698801-8698823 CTCTCTAAAATTTACACGTAAGG - Intronic
1094671539 12:32574961-32574983 TTCTCTAAGATTAACATTCAGGG - Intronic
1095250382 12:39972215-39972237 ATCTCTAAGAATCACATGGCAGG + Intronic
1097443579 12:59641626-59641648 TTTTCTAATATTTACATTGAAGG + Intronic
1099369252 12:81810370-81810392 CTTTCTAGAATTTACGTGGAAGG + Intergenic
1099448097 12:82775980-82776002 CTCTCAAAGTTGTACATGCATGG + Intronic
1103454757 12:121056435-121056457 CTCTCCAAGATATTCATGGCAGG + Intergenic
1109649992 13:65312026-65312048 TTCTCTAAGGTTTACATTGTAGG + Intergenic
1110525320 13:76529881-76529903 CCGTCTAAGATATAAATGGATGG + Intergenic
1112953353 13:105030023-105030045 CTCTCTAAGCCGTAAATGGAGGG - Intergenic
1118799548 14:69177064-69177086 CTCTCTAATAGTTACTTGGTTGG - Intergenic
1119939126 14:78621973-78621995 GTGTCAAAGATTTACATAGAGGG + Intronic
1120129294 14:80786192-80786214 CTCTCTAAGATTTACATGGAAGG + Intronic
1127856437 15:62957533-62957555 CTCTCTGAGAGGTACATGCAGGG - Intergenic
1131205418 15:90441590-90441612 CTCTTCAAGATTTACAAGCATGG - Exonic
1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG + Intronic
1133388672 16:5391351-5391373 CTCTCAAAGATGAAAATGGAAGG - Intergenic
1135012968 16:18900463-18900485 CTCTCTAATACTTACAAGAATGG - Intronic
1135319889 16:21488035-21488057 CTCTCTAATACTTACAAGAATGG - Intergenic
1135372725 16:21919522-21919544 CTCTCTAATACTTACAAGAATGG - Intergenic
1135439057 16:22451179-22451201 CTCTCTAATACTTACAAGAATGG + Intergenic
1136330122 16:29569747-29569769 CTCTCTAATACTTACAAGAATGG - Intergenic
1136444746 16:30309452-30309474 CTCTCTAATACTTACAAGAATGG - Intergenic
1137864651 16:51880675-51880697 CTCTGTAAAATGTAGATGGATGG - Intergenic
1138160953 16:54753912-54753934 GACTCACAGATTTACATGGATGG + Intergenic
1142524154 17:526770-526792 CTCTCAAAGATTTCCATTGCTGG - Intronic
1143426117 17:6839730-6839752 CCATCTAAGAATTAAATGGAAGG - Intergenic
1145113028 17:20182000-20182022 CTTTCTAAGACTTAAATGTAAGG - Intronic
1145800726 17:27683040-27683062 CTCTTAAAGATTTATATGGAGGG + Intergenic
1146232873 17:31129723-31129745 CTCTATAAGAATTTCATGGCCGG - Intronic
1151430851 17:74061704-74061726 CTTTCTAAGGCTAACATGGATGG - Intergenic
1151863184 17:76781506-76781528 CACACTGAGACTTACATGGAAGG + Intergenic
1153250730 18:3119086-3119108 CTCTGTAAGAGTTACAAGCAAGG + Intronic
1153994117 18:10424793-10424815 CTCTCTCTGATCTCCATGGATGG + Intergenic
1154081992 18:11266676-11266698 CTCCCTAAGATTAACAAAGAGGG + Intergenic
1155030751 18:21981490-21981512 CTCTCTAAGATTGATAGAGAGGG + Intergenic
1156106154 18:33664221-33664243 ATCTCTAAGATTTACTTGCTGGG - Intronic
1158326681 18:56320510-56320532 CACTCTAAAATATACCTGGATGG - Intergenic
1159893395 18:73973966-73973988 CTCTCTGGGATTTACAAGCACGG + Intergenic
1160072454 18:75640542-75640564 CTCTGTAAGGTTTAAGTGGAAGG - Intergenic
1161122668 19:2538279-2538301 CTCTCTAAAATTGACCTGGTCGG - Intronic
1167714886 19:51136907-51136929 CTCACTGAGATCTACATGGAAGG + Intergenic
929227303 2:39524143-39524165 CTCTCCAACTTTTCCATGGACGG + Intergenic
930360757 2:50376232-50376254 CTCTTTCAGACTTACATGGTAGG - Intronic
931552985 2:63467907-63467929 CTCACAAAGATTTACATTAAAGG - Intronic
932297785 2:70641502-70641524 CTCTCTCACAATTACAGGGAAGG - Intronic
932739840 2:74283003-74283025 CTATCCAAGATTGACAGGGAAGG - Intronic
933121668 2:78545908-78545930 ATTTCTAAGATATACAAGGATGG + Intergenic
937484727 2:122303235-122303257 CTTTCTAACATTTTCATGTAGGG - Intergenic
944135784 2:196397894-196397916 CTCCCAAAGATATTCATGGAAGG + Intronic
1169976194 20:11331146-11331168 ATCTATATGATTTACATAGATGG + Intergenic
1169992835 20:11522731-11522753 CTCTCTAAGAGTGAACTGGAGGG + Intergenic
1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG + Exonic
1178635673 21:34300291-34300313 CTCCCTAAGATTAATATGAACGG - Intergenic
1182290604 22:29276150-29276172 GTCTATAAGATTTACAAGGAGGG - Intronic
1184630287 22:45772549-45772571 TATTCTAAAATTTACATGGAAGG - Intronic
949372542 3:3351431-3351453 CTCTCTATGGTTAACACGGAAGG - Intergenic
951713723 3:25613963-25613985 CACTCTAAGCATTACATAGAAGG + Intronic
951989072 3:28655739-28655761 CACGCTGAGATTCACATGGAAGG - Intergenic
955497328 3:59547500-59547522 CTCTTCAAGAATTACAGGGAAGG - Intergenic
956333438 3:68136807-68136829 CTCTCCAAGATGTACACTGATGG - Intronic
958732869 3:97977498-97977520 CTCTCCAAGTTTTACATGTGAGG + Intergenic
963066531 3:141268870-141268892 CTCTCTAGGATTTATCTGGCTGG + Intronic
963924218 3:150934542-150934564 CTCTCTGAGAATGACATGAAAGG - Intronic
967372243 3:188759910-188759932 CTCTGCAAGATTGGCATGGAGGG - Intronic
967599772 3:191371885-191371907 ATTTCTAAGATTTAAATTGAAGG - Intronic
967749592 3:193099004-193099026 CCCTACCAGATTTACATGGATGG + Intergenic
969939316 4:10714328-10714350 CTGTTTAAGTTTTTCATGGAGGG - Intergenic
970013488 4:11486344-11486366 CTCTAAGAGTTTTACATGGATGG + Intergenic
973084248 4:46034989-46035011 TTCTCTTTCATTTACATGGAAGG - Intergenic
973203414 4:47531586-47531608 CCATCTAAAATTTCCATGGAAGG - Intronic
975391998 4:73831203-73831225 CTCTTTAAGATCTACTTGTAAGG + Intergenic
975407253 4:74003897-74003919 CTCTTTAAGATCTACTTGTAAGG - Intergenic
977577756 4:98692819-98692841 CTCTCCAAGATTTATAATGAGGG - Intergenic
977888907 4:102283944-102283966 CTCTCGGATATTCACATGGATGG + Intronic
981564282 4:146081725-146081747 ATCTCTAACATTTTCATAGAGGG + Intergenic
983089905 4:163490747-163490769 GCCTCTAATATTTACATGAATGG + Intergenic
984212326 4:176865372-176865394 TTCTCTAAAATTTACTTGGTTGG - Intergenic
986509798 5:8492023-8492045 CTCTCTAAGATGCACTTAGAGGG - Intergenic
987083182 5:14444636-14444658 CTCTCCAAAATCTACATTGAAGG + Intronic
987883387 5:23779688-23779710 CTCTACAAGGTGTACATGGAAGG + Intergenic
989441158 5:41473895-41473917 CTCTCATAAATTTACATGGAAGG - Intronic
990867814 5:60399452-60399474 CCCACTAAGATTCACATGGCAGG - Intronic
991486851 5:67145841-67145863 CTCTCTAGCATTGAAATGGATGG + Intronic
995844094 5:116474973-116474995 ATCTCTGAGATTTACATAGTAGG + Intronic
996613933 5:125416773-125416795 CTCTCTCATAGTTACGTGGAAGG + Intergenic
996740620 5:126795559-126795581 TTCTCTAAGAGTTCCATTGAGGG + Intronic
998002522 5:138636270-138636292 TTCTCAAAGATTTAGAGGGAGGG - Intronic
999120926 5:149208887-149208909 ATCTCTGAGAGTTCCATGGAAGG + Intronic
1003731097 6:8825538-8825560 CTCCCTAAGATTACCGTGGATGG - Intergenic
1005016022 6:21376149-21376171 CCCTCTCAGCTTTGCATGGAAGG - Intergenic
1012002429 6:93669422-93669444 CTCTCAAAGACCTACCTGGAAGG + Intergenic
1017503041 6:155043119-155043141 CTTACTAAGAGTTACATAGATGG + Intronic
1023042768 7:36186466-36186488 TCCTCTAAGACTTCCATGGAAGG - Intronic
1024523835 7:50331153-50331175 CTTTCAAAGATTTACAAGAAGGG + Intronic
1031448669 7:121886795-121886817 TTCTCAAAGGTTTCCATGGATGG - Intronic
1034612369 7:152382881-152382903 CTCTCAAAGATTGAGGTGGAGGG + Intronic
1036411804 8:8508663-8508685 CTCTCTAAATTTTGCAAGGAAGG - Intergenic
1038601697 8:28950477-28950499 CACTCTGAGATTTCCATAGAAGG + Intronic
1039844276 8:41314935-41314957 CACTGTACGATGTACATGGAAGG - Intergenic
1040149537 8:44097451-44097473 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040151992 8:44133828-44133850 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040157567 8:44216384-44216406 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040158906 8:44236195-44236217 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040174476 8:44466709-44466731 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040200911 8:44858048-44858070 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040206599 8:44942472-44942494 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040207853 8:44960971-44960993 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040218599 8:45120026-45120048 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040225853 8:45227097-45227119 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040240026 8:45436040-45436062 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040246530 8:45531681-45531703 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040260325 8:45735300-45735322 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040262060 8:45760947-45760969 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040264680 8:45799677-45799699 CTGTCTAATTTTTACATGTAAGG - Intergenic
1040269733 8:45874350-45874372 CTGTCTAATTTTTACATGTAAGG - Intergenic
1043051619 8:75392812-75392834 CTATCTAACATTTTCCTGGAAGG + Intergenic
1044263424 8:90155031-90155053 CTTTCTAAAATTTACTTGAAAGG - Intergenic
1044568963 8:93697120-93697142 CTGTCTGAGATTTAGTTGGAGGG - Intergenic
1044803362 8:95979621-95979643 CTCTCTTACATTTACAGCGAAGG + Intergenic
1046169317 8:110484970-110484992 CTCTGTAACATTTGCATGAAGGG + Intergenic
1053462674 9:38282699-38282721 TTCTCTATGCCTTACATGGATGG + Intergenic
1055151056 9:73000326-73000348 GTTTCTAATGTTTACATGGAGGG - Intronic
1056296767 9:85201094-85201116 CTCTCTTATCTTTTCATGGATGG + Intergenic
1056296845 9:85201765-85201787 CTCTCTTATCTTTTCATGGATGG + Intergenic
1057298957 9:93865539-93865561 CTCTCTGAGATGGCCATGGAGGG - Intergenic
1059860873 9:118460040-118460062 ATCTGTAAGATTCACAGGGATGG - Intergenic
1186322796 X:8448731-8448753 TTCTATAAGATTTCTATGGAAGG + Intergenic
1189564549 X:42228048-42228070 CTTTCTGTGATTTACTTGGAGGG + Intergenic
1190142898 X:47863586-47863608 CTCTCTAAGGTTCACATGAACGG - Intronic
1198939591 X:141938839-141938861 CTTGCTAAGATTTAGATGCATGG - Intergenic
1202068905 Y:20969830-20969852 ATCTCAAAGATTAACAGGGATGG - Intergenic