ID: 1120129528

View in Genome Browser
Species Human (GRCh38)
Location 14:80788693-80788715
Sequence GAGGATCATATTGTTCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129528_1120129538 25 Left 1120129528 14:80788693-80788715 CCCTTTAGAACAATATGATCCTC 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129528_1120129534 7 Left 1120129528 14:80788693-80788715 CCCTTTAGAACAATATGATCCTC 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1120129534 14:80788723-80788745 CCTTACCCTACTTCTCCTCTCGG 0: 1
1: 0
2: 1
3: 32
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129528 Original CRISPR GAGGATCATATTGTTCTAAA GGG (reversed) Intronic
900577634 1:3391333-3391355 GAGGATCAGTTTGTTCCAAAGGG - Intronic
908140017 1:61174498-61174520 GAGTAACAAATTCTTCTAAAAGG - Intronic
908727399 1:67191543-67191565 GAGGGTTATATTTTTCAAAAGGG - Intronic
911132449 1:94403170-94403192 GAGGATCATTTTGTTTAAAAAGG - Intergenic
915868643 1:159533707-159533729 GAGGTTCATAGTTTTCTAGAGGG - Intergenic
917086026 1:171306640-171306662 GTGGATCAAATTGGTCTCAATGG - Intergenic
917833383 1:178917425-178917447 CAGGATCATATTTGTTTAAAAGG + Exonic
923427827 1:233890062-233890084 GAGTATCATAGGGTTATAAAGGG + Intergenic
1065085966 10:22176754-22176776 GAGGATCATATAATCATAAAAGG + Intergenic
1065986490 10:30958629-30958651 GAGGACCAGAATGTACTAAATGG + Intronic
1066327579 10:34378787-34378809 GGGGATCATATTATGCTTAAAGG + Intronic
1072871157 10:99121941-99121963 TAGGATCATATTATTTTTAATGG - Intronic
1073596068 10:104801386-104801408 GAGGAAATTATAGTTCTAAAAGG - Intronic
1073822997 10:107286592-107286614 CAGGATCTTATTCTTTTAAATGG + Intergenic
1074941452 10:118239895-118239917 GAGAATCATATTTTGCTATAAGG + Intergenic
1079896313 11:26123361-26123383 TAAGATCATATAGTTCTAAGTGG + Intergenic
1086518110 11:87637768-87637790 GAAGATAATTTTATTCTAAAGGG + Intergenic
1087852530 11:103048856-103048878 GAGGACCACATTGATGTAAATGG + Intergenic
1088915884 11:114227361-114227383 GAAGCTCCTATTGTTCTAAGGGG - Intronic
1089811239 11:121133607-121133629 GAGGATCATTCTGTTTCAAAAGG - Intronic
1096862236 12:54538140-54538162 GCGGATCATATTGTTCTCTCAGG + Intronic
1099396191 12:82143906-82143928 GAAAATCAGATTGTTCTACAGGG + Intergenic
1100029729 12:90171558-90171580 TAGGTTCATATTGATCTTAATGG + Intergenic
1102324298 12:111965980-111966002 GAGGATGAGAATGTTTTAAATGG - Intronic
1106382170 13:29250386-29250408 AAGAATCATATTTTTCTGAATGG - Intronic
1107892416 13:44925909-44925931 GAGGATAATAATTTTATAAAGGG + Intergenic
1108492389 13:50994269-50994291 GAGGCTCACCTTGTTTTAAAGGG - Intergenic
1110769939 13:79330987-79331009 GAGAATCATGTTTTACTAAATGG - Intronic
1112598819 13:100834508-100834530 ATGTGTCATATTGTTCTAAAAGG - Intergenic
1113306097 13:109080211-109080233 GTGGATAATATTTTTCTATATGG + Intronic
1120129528 14:80788693-80788715 GAGGATCATATTGTTCTAAAGGG - Intronic
1121099049 14:91237246-91237268 GAGGAAACTATGGTTCTAAAGGG + Intronic
1127445166 15:59054372-59054394 AAGCATCATATTGTACTAGATGG - Intronic
1127530388 15:59837792-59837814 GAGGCTCCTATTGGTCAAAAGGG + Intergenic
1127532791 15:59861383-59861405 GAAGATCATATCTTTTTAAAAGG + Intergenic
1128875930 15:71201327-71201349 GAGGATGATATTGATCTCACAGG + Intronic
1129087403 15:73109669-73109691 CAGGATCATAATGTCCTATAGGG - Intronic
1135581405 16:23630115-23630137 GAGGACCTTATTGTTCTACCAGG - Exonic
1137990576 16:53150484-53150506 TAGGATCATATTTTTTAAAAAGG + Intronic
1144594210 17:16553223-16553245 TAGGATCATATTCTTGTGAAAGG + Exonic
1144745895 17:17614222-17614244 GAGAATCACATTGTTCCAAATGG - Intergenic
1145021201 17:19432589-19432611 GAGGATCACATTGTCTAAAATGG - Intergenic
1146369599 17:32257156-32257178 GAGTACCAGATTGTTCTAAAGGG + Intergenic
1147188403 17:38725261-38725283 GAGGGTCATCTTTTTCTAATTGG - Intronic
1148407245 17:47426504-47426526 GGGGATCAAATTGTTTTAAGAGG + Intronic
1153693559 18:7617218-7617240 GAGGATTTTATGGTTTTAAAGGG + Intronic
1164025282 19:21346048-21346070 GAGGATCATATTGTTTGGACTGG - Intergenic
926290199 2:11522910-11522932 GAAGATGATATTTTTCTAACTGG - Intergenic
930635521 2:53801311-53801333 GAGGAACTTATTATTCTGAAAGG - Intronic
931307898 2:61050089-61050111 GAGGATTATCATATTCTAAATGG - Exonic
932125142 2:69138343-69138365 CAGGATCATATTGTCCTAGTTGG + Intronic
932634009 2:73372082-73372104 GAGGGTCATATGGTTATCAAAGG - Intergenic
933483825 2:82893177-82893199 CAGAATCACATTGTCCTAAAAGG - Intergenic
933610959 2:84434670-84434692 GGTGATCATATTGTTAGAAAAGG - Intronic
934628377 2:95885678-95885700 TCAGATCATATTGTTATAAACGG - Intronic
935551217 2:104457594-104457616 GAGGATCATTTTTTTTTATATGG + Intergenic
937695106 2:124800166-124800188 GAGGATGATATTGTTTAGAACGG - Intronic
941375543 2:164724521-164724543 GAGTAGCAAATTTTTCTAAAAGG + Intronic
941853024 2:170203195-170203217 GAGCATCATGTTTTTCTTAAAGG - Intronic
944448161 2:199813288-199813310 GAGAATAATTTTGATCTAAAGGG - Intronic
944486371 2:200210601-200210623 GATTATAATATTGTTCTTAATGG - Intergenic
947557654 2:231110601-231110623 GAGGAACATATTCTTGTCAATGG - Intronic
948320275 2:237063261-237063283 TGTGATCATATTGTTTTAAATGG - Intergenic
1171331374 20:24341746-24341768 GCAGATTATATTTTTCTAAAAGG - Intergenic
1174916801 20:54662170-54662192 GAGGATCATTTGGTTATCAAAGG + Intergenic
1177295696 21:19172238-19172260 GAGGATCATGTTTTTATAATTGG - Intergenic
1178520663 21:33286290-33286312 GAAGATCATGTCGTTTTAAAGGG - Intronic
1178673127 21:34609512-34609534 GTGGATCACATTTTTTTAAAAGG + Intronic
1180357068 22:11851642-11851664 AAGGATGATATTACTCTAAATGG - Intergenic
1180381195 22:12140689-12140711 AAGGATGATATTACTCTAAATGG + Intergenic
1182001448 22:26923226-26923248 GAGGATCAGAGTCTTCTAGAAGG + Intergenic
1182436483 22:30333991-30334013 GAGGATCCCAATGTTTTAAAAGG + Exonic
949093065 3:52269-52291 CCAGAACATATTGTTCTAAAAGG - Intergenic
951037203 3:17946661-17946683 GTGCATCATATTGTGCTGAATGG + Intronic
957338567 3:78863293-78863315 TAGGCTCATAGAGTTCTAAATGG - Intronic
957654429 3:83056199-83056221 GAGTATCATATTTTTCTCCAAGG - Intergenic
959743078 3:109743730-109743752 CAGCATCTTATTTTTCTAAAGGG - Intergenic
961200329 3:125040450-125040472 GAAGGTCATATTGCTCAAAAGGG + Intronic
961358814 3:126355195-126355217 GATGATCATATTGTGGTTAAAGG + Intronic
962190259 3:133302796-133302818 TAGGATAACATTGATCTAAAGGG - Intronic
963787775 3:149552394-149552416 GATGATCATCTTGCTATAAATGG - Intronic
967295856 3:187964043-187964065 GAAGATCATATTATTTTTAAAGG + Intergenic
967514179 3:190347424-190347446 AAGGAACATATAGTTATAAATGG + Intronic
970894003 4:21080424-21080446 AAAGATCTTATTGTTCCAAAAGG - Intronic
970937171 4:21586747-21586769 GAGAACCATATTTTTATAAATGG - Intronic
975081019 4:70280751-70280773 GAGGAGCCCATTGTCCTAAAGGG + Intergenic
975769200 4:77703032-77703054 GAAGATCCTATAATTCTAAACGG + Intergenic
976112563 4:81691540-81691562 GAGGATCACATTGTCCTTGATGG - Intronic
977315991 4:95448459-95448481 GAGGATCAAATTAATTTAAATGG + Intronic
978345848 4:107768431-107768453 GAGGCTGATATTGTTCTCCAGGG - Intergenic
983352102 4:166602873-166602895 AAGGATAATATTGATCTAACCGG + Intergenic
985530440 5:430902-430924 GAGGAACATAGAATTCTAAAGGG + Intronic
985885613 5:2675390-2675412 AAGGTTCAAAATGTTCTAAAGGG + Intergenic
987907896 5:24102565-24102587 GAAGTACATATTGTTCTACAGGG - Intronic
992481214 5:77154116-77154138 GAATTTCATATTGTTCAAAATGG + Intergenic
992764685 5:79986661-79986683 GTGGGTCATTTTCTTCTAAAAGG - Intronic
993646287 5:90467418-90467440 GAGGAACATATAGTGATAAAAGG - Intronic
996350363 5:122533754-122533776 GAGGATCTTACTATTCTTAAAGG - Intergenic
998644485 5:144047331-144047353 GAGGATAATATTGTTGCAAAAGG + Intergenic
999613366 5:153395125-153395147 GAGGATTATAGTTTTCTACAGGG + Intergenic
1002556820 5:180048362-180048384 GAGGATGATATTATTATCAAAGG + Intronic
1002684181 5:180994712-180994734 GAGGAAAATATTTTTTTAAAGGG - Intronic
1003227680 6:4221279-4221301 GGGGATCAGATTGTTTGAAAGGG + Intergenic
1003262466 6:4532002-4532024 GAGAATCAAATTGATCTCAATGG - Intergenic
1003327440 6:5103087-5103109 GAAGATCGTATTGTTCTCAGAGG + Intronic
1008533659 6:52489386-52489408 GTGGCCCATTTTGTTCTAAAAGG + Intronic
1009160749 6:60278975-60278997 GAGGATTATATCTTTCTAGAAGG + Intergenic
1009850367 6:69189595-69189617 GAGAATCATATTGAACTAGATGG - Intronic
1010039568 6:71365279-71365301 AAAGACCACATTGTTCTAAATGG + Intergenic
1010370943 6:75106610-75106632 AAGGATCACATTGCTCTCAATGG - Intronic
1010612439 6:77970400-77970422 TAGAATCATATTGTTCGTAAAGG - Intergenic
1012394342 6:98778773-98778795 GAGGACCATAGTATTCCAAAGGG - Intergenic
1012568650 6:100694622-100694644 GAAGATCCTATTGTGCAAAATGG + Intronic
1014809663 6:125871053-125871075 GAGGTTCAGTTTGCTCTAAATGG + Intronic
1015927956 6:138329126-138329148 GAGGATGATAGTGTTTAAAAAGG - Intronic
1017075753 6:150616315-150616337 GAGGATGGTATTGTTGTAGAAGG + Intronic
1017644910 6:156530384-156530406 CAGGATCATATTGTTTTAATTGG - Intergenic
1024390349 7:48804078-48804100 GAGGATTACATTGTTCAAATAGG - Intergenic
1025848593 7:65222972-65222994 TAGGATCATATTGTTTGAACTGG - Intergenic
1029055452 7:97735847-97735869 GATGATTATAATCTTCTAAAAGG - Intronic
1031927756 7:127654072-127654094 GAGGTTTAAATTGTTCTTAAAGG + Intronic
1032160749 7:129508200-129508222 GAGGTTCATTTTTTTGTAAATGG + Intronic
1032307727 7:130752945-130752967 GGGGATCATCTTGTTCTCATTGG - Intergenic
1032684332 7:134216275-134216297 GAGGATGATACTGTTCAAACTGG + Intronic
1036017907 8:4806573-4806595 GATAATCATATTTTTCAAAAAGG + Intronic
1040655883 8:49506830-49506852 GAGGATAATTTTGTTTGAAAGGG + Intergenic
1041126058 8:54640151-54640173 GAGGTTCATTTTATTTTAAATGG + Intergenic
1042693597 8:71530970-71530992 AAGGAGCATTTTGTTATAAATGG - Intronic
1043702551 8:83308757-83308779 TAGGATTATATTTTTTTAAATGG + Intergenic
1043825416 8:84922915-84922937 GAGTATCATATTGTCCCCAATGG + Intergenic
1044005569 8:86932731-86932753 GAGGGTCAAATTGTTCCCAATGG + Intronic
1044506905 8:93031825-93031847 GAGAATTATATTCTTCCAAATGG + Intergenic
1045229028 8:100282853-100282875 GTGGAGAATATTGTTCTTAATGG - Intronic
1046823814 8:118664700-118664722 GAGAATCAGATTTTTCTTAATGG + Intergenic
1051065776 9:13100819-13100841 GAGAATCATCTTTTTCTAATGGG + Intergenic
1051120435 9:13746449-13746471 GAGGATCATATGGTTCTTGATGG + Intergenic
1052820473 9:33134516-33134538 GAGAATCAGATTGATCTAAGAGG - Intronic
1055115428 9:72600208-72600230 TTGGTTCATTTTGTTCTAAATGG + Intronic
1055193426 9:73556511-73556533 GAGATTCAAATTGTTCTTAAGGG - Intergenic
1055495837 9:76854501-76854523 AAGTATCATTTTGTTCTAAGGGG + Intronic
1055646453 9:78365985-78366007 GAGTTTCATATTTTACTAAAAGG + Intergenic
1055867128 9:80828192-80828214 GAGGAGCATATTGACCCAAAAGG - Intergenic
1203695537 Un_GL000214v1:94159-94181 AAGGATGATATTACTCTAAATGG + Intergenic
1203702323 Un_KI270742v1:6746-6768 AAGGATGATATTACTCTAAATGG - Intergenic
1203640736 Un_KI270751v1:9904-9926 AAGGATGATATTACTCTAAATGG - Intergenic
1186770017 X:12808782-12808804 GAGGAGAATAGTGTTCTAGAAGG - Intronic
1187104476 X:16226581-16226603 GATGAACATATTTTTTTAAAGGG + Intergenic
1187181711 X:16948726-16948748 GAGGTACATATAGTTTTAAAAGG + Intronic
1188721499 X:33528476-33528498 GAGGAGCACATTGTCCTGAAGGG - Intergenic
1192417705 X:70998459-70998481 GAAGATCATGTTTTCCTAAATGG + Intergenic
1194323169 X:92477487-92477509 GAGGAGCCCATTGTTCTGAAGGG - Intronic
1194818913 X:98481362-98481384 CAGCATCATCTTATTCTAAATGG - Intergenic
1194928304 X:99855889-99855911 TAGAATCAAATAGTTCTAAAAGG - Intergenic
1197916403 X:131540605-131540627 GAGGAACATATAGTTTTAAATGG + Intergenic
1198411825 X:136377694-136377716 GAGGATCATTTTGTTTTACGTGG + Intronic
1198606097 X:138339460-138339482 GAGAAGCATATTGATCTAAGAGG - Intergenic
1200631266 Y:5590644-5590666 GAGGAGCCCATTGTTCTGAAGGG - Intronic
1201366536 Y:13212800-13212822 GAGTCTGATATTGTTGTAAAAGG + Intergenic