ID: 1120129529

View in Genome Browser
Species Human (GRCh38)
Location 14:80788694-80788716
Sequence AGAGGATCATATTGTTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129529_1120129538 24 Left 1120129529 14:80788694-80788716 CCTTTAGAACAATATGATCCTCT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129529_1120129534 6 Left 1120129529 14:80788694-80788716 CCTTTAGAACAATATGATCCTCT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1120129534 14:80788723-80788745 CCTTACCCTACTTCTCCTCTCGG 0: 1
1: 0
2: 1
3: 32
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129529 Original CRISPR AGAGGATCATATTGTTCTAA AGG (reversed) Intronic
900577635 1:3391334-3391356 AGAGGATCAGTTTGTTCCAAAGG - Intronic
904846716 1:33424715-33424737 AGAAAATAATATTTTTCTAAGGG + Intronic
910509006 1:87982787-87982809 AGTGGAACATATGGTGCTAAAGG + Intergenic
911694723 1:100877271-100877293 AGAGGTTAATATTGTAATAAAGG - Intronic
912626665 1:111210836-111210858 AGAGGAACAGATAGTTCTCATGG + Intronic
918019353 1:180670007-180670029 AGAATATCATATTTTTTTAAAGG - Intronic
918685548 1:187410192-187410214 ATAGGAACATATTGGTCAAATGG + Intergenic
923427826 1:233890061-233890083 AGAGTATCATAGGGTTATAAAGG + Intergenic
1062811547 10:470200-470222 AGAGTATCATGTGGTTATAATGG + Intronic
1062958287 10:1554356-1554378 AGAGAGTCATTTTGTTCTCACGG + Intronic
1066271182 10:33825099-33825121 AGAGGATCATACAGTTCAAGAGG - Intergenic
1067678319 10:48406678-48406700 AGAGGATGAAATTGTTTAAAAGG - Intronic
1072795410 10:98350944-98350966 TGAGGATGATATTCTTCTCAAGG + Intergenic
1073664245 10:105511860-105511882 ATATGATCATTTTGTTCTTAAGG - Intergenic
1073917324 10:108420787-108420809 GGAGAATCTTATTTTTCTAAAGG - Intergenic
1075220525 10:120580772-120580794 AAACAATCATATTGTTCCAAGGG - Intronic
1076415813 10:130287655-130287677 GGAGGGTCATTTTGGTCTAATGG + Intergenic
1079374880 11:19882924-19882946 AAAGGATAATCTTGTTCTCAAGG + Intronic
1079840372 11:25390286-25390308 AGAGGATCATATATCTCAAATGG - Intergenic
1081187887 11:40067120-40067142 AGAGCAGCATCTTGTTCTTAAGG - Intergenic
1082013941 11:47470367-47470389 AAAGGATAAAACTGTTCTAAAGG - Exonic
1086216358 11:84386992-84387014 AGAGGTTCAGAATCTTCTAAAGG - Intronic
1087554604 11:99700174-99700196 ATAACATCATAATGTTCTAATGG + Intronic
1088398192 11:109391724-109391746 AGATGAACATATTGTTCAACTGG + Intergenic
1088915885 11:114227362-114227384 TGAAGCTCCTATTGTTCTAAGGG - Intronic
1090827485 11:130397949-130397971 AGTGGAACATATTTTTCAAAGGG + Intergenic
1093223069 12:16446936-16446958 AGAGGATTATATTGTTCCATGGG - Intronic
1093500521 12:19806635-19806657 AGACCATCATTTTATTCTAATGG + Intergenic
1094162061 12:27401753-27401775 AGAGGATCACACAGTTTTAATGG - Intronic
1097359021 12:58637007-58637029 AGAGGAAGATATTGATCAAAGGG + Intronic
1099168960 12:79340742-79340764 AGTGTTTCATATTGTTTTAAAGG + Intronic
1099440693 12:82696026-82696048 AGAGGAGGAACTTGTTCTAAAGG - Intronic
1101173621 12:102125802-102125824 TGAGCATCATATTCTTCTTATGG - Intronic
1105914773 13:24903328-24903350 ATAGGGTCATATTGGTTTAAGGG - Intronic
1105936334 13:25103261-25103283 ATAACATCATGTTGTTCTAATGG + Intergenic
1108453038 13:50586301-50586323 AGAGGATTTTGTTGTTCTGAGGG + Intronic
1108918304 13:55643733-55643755 AGAGGAAAATATTGGTCAAAGGG + Intergenic
1109384745 13:61612224-61612246 AGAAGATAATATATTTCTAAGGG + Intergenic
1109890417 13:68604658-68604680 AGAAGATCTTATTATGCTAATGG + Intergenic
1112824748 13:103379366-103379388 AGTGGATTATAATGCTCTAATGG + Intergenic
1117671243 14:58108155-58108177 CCAGGATCATAAGGTTCTAAGGG + Intronic
1117829735 14:59738829-59738851 ACAGGATCATATTCTTCACAGGG + Intronic
1120129529 14:80788694-80788716 AGAGGATCATATTGTTCTAAAGG - Intronic
1120246799 14:82016334-82016356 AGTGGATCATATTTGTGTAATGG - Intergenic
1120333754 14:83127329-83127351 AGAGGATCAAATTCTTCCTAGGG + Intergenic
1121985106 14:98497893-98497915 CGAGAATCAAATTGTTCTGATGG - Intergenic
1126479228 15:49099477-49099499 AGAAGATCATATTCTTAAAATGG - Intergenic
1129892721 15:79082189-79082211 AGAGGAGAATATGGTGCTAATGG - Intronic
1131947419 15:97640452-97640474 AGAGGTTCATATTGATTAAATGG + Intergenic
1139102983 16:63790744-63790766 AGAGTCTTAAATTGTTCTAAAGG - Intergenic
1140213360 16:72988078-72988100 TGTGGACCATATTGTTCTTAGGG - Intronic
1146369598 17:32257155-32257177 GGAGTACCAGATTGTTCTAAAGG + Intergenic
1148583928 17:48763389-48763411 TGAGGATGATATTGTGCTGATGG - Intronic
1149635117 17:58160629-58160651 AGAGGAAAATGCTGTTCTAAGGG - Intergenic
1153693558 18:7617217-7617239 AGAGGATTTTATGGTTTTAAAGG + Intronic
1159170148 18:64755912-64755934 AGTTGATCATATTATTCTGATGG + Intergenic
1160038371 18:75321746-75321768 AGAGGATGATATTGGAGTAAAGG + Intergenic
1164889801 19:31813645-31813667 AGGGGACCCTATTATTCTAATGG - Intergenic
925417761 2:3683495-3683517 AGATGATAAAAATGTTCTAAAGG - Intronic
932763457 2:74455608-74455630 AGAGGGTCATAGTTTTATAAGGG + Intronic
933192282 2:79348203-79348225 AAAGGACTATATTGTTCTATTGG + Intronic
933218082 2:79653428-79653450 AGAGGAGCCTGTTTTTCTAATGG - Intronic
933305312 2:80589839-80589861 AGAGGTACATATTTTTCCAAAGG - Intronic
933472329 2:82741946-82741968 AGAGGAACATGTTGTACTTAAGG - Intergenic
940248373 2:151645253-151645275 AGAGCATCTAATTCTTCTAATGG + Intronic
940937699 2:159517585-159517607 ACATGATTATATTGTTGTAACGG - Intronic
943298695 2:186170750-186170772 AGAGGATCAGATGATTTTAATGG - Intergenic
946264164 2:218523876-218523898 ACAGGGTGATATTGTTCTGAAGG - Intronic
1170750088 20:19137739-19137761 AGAGCATCTAATGGTTCTAAAGG - Intergenic
1172414125 20:34750244-34750266 AAAGGATCATAGGGTTCTGAGGG + Exonic
1173379093 20:42521663-42521685 ATCAGATAATATTGTTCTAATGG - Intronic
1176607074 21:8842374-8842396 AGAGGATGATATTGCTCCAAAGG - Intergenic
1176888702 21:14287586-14287608 AGAGGATCTTTTTGAACTAAAGG + Intergenic
1177223938 21:18229448-18229470 ACAGGGTCATATTTTTCTCATGG + Intronic
1178249929 21:30993065-30993087 AGAATATCAGAATGTTCTAAAGG - Intergenic
1182979490 22:34655068-34655090 AGAGGTTCATAGTGTCCTCAAGG - Intergenic
952288053 3:31987280-31987302 AAAGGATAATATAGCTCTAAAGG - Intronic
953123012 3:40064312-40064334 ACAGGATTATATTCCTCTAAGGG + Intronic
961581324 3:127885536-127885558 TAAAGATCATATAGTTCTAAGGG - Intergenic
962941714 3:140130595-140130617 AGAGGCTCACATTCTTCTAATGG + Intronic
963094253 3:141518708-141518730 AGAAAAACATATTGTTTTAAAGG - Intronic
965267445 3:166562008-166562030 AGAAAATCATATTGTTATATGGG + Intergenic
965970007 3:174543202-174543224 AGAAGATGATATTATTATAATGG - Intronic
967871513 3:194233702-194233724 TGCGGATGATTTTGTTCTAAGGG - Intergenic
971239251 4:24872936-24872958 AGTGGGTCATACTGTTCTATGGG - Intronic
971694310 4:29878434-29878456 AAAGAATTATATTGTTTTAAAGG + Intergenic
971872583 4:32263141-32263163 AGAGTATTATCTGGTTCTAAAGG + Intergenic
973928544 4:55765367-55765389 AGAGGATCAGAAAGTCCTAAGGG + Intergenic
975081018 4:70280750-70280772 AGAGGAGCCCATTGTCCTAAAGG + Intergenic
977540105 4:98307004-98307026 AGTGAATCATTTTTTTCTAATGG + Intronic
979724846 4:123948432-123948454 AGTGTCTCATATAGTTCTAAGGG + Intergenic
982568052 4:157011574-157011596 AGAGGATAATATTATTCCACAGG - Intergenic
983517790 4:168675622-168675644 AGAAAATCAGATTGTTGTAAGGG + Intronic
984023936 4:174520806-174520828 AGAGGAACATATTGTACCAGAGG - Intronic
984182283 4:176498462-176498484 AGAGGTTTATATTATTGTAAGGG + Intergenic
985885612 5:2675389-2675411 AAAGGTTCAAAATGTTCTAAAGG + Intergenic
989740506 5:44765704-44765726 AGAGAATAATATAGGTCTAATGG + Intergenic
993252336 5:85544888-85544910 AGAGGGTGATATTATTTTAATGG + Intergenic
995675909 5:114662205-114662227 AGAGGCTCATCTTACTCTAAAGG - Intergenic
999285369 5:150391367-150391389 AGCGAATCACATTGTTCTCAAGG - Intronic
1002481538 5:179504321-179504343 AGAGGATGATCTTTTCCTAACGG - Intergenic
1002684182 5:180994713-180994735 AGAGGAAAATATTTTTTTAAAGG - Intronic
1007427604 6:41757525-41757547 AGAGGATCATATAGCTCTGAGGG + Intergenic
1009301544 6:62030268-62030290 AGAAAATTATATTGTTCTAAGGG - Intronic
1009534872 6:64868748-64868770 ACAGGAACATATTTTTCTGAAGG + Intronic
1009841410 6:69080286-69080308 AGAGGAACATATTTTTCTTAAGG - Intronic
1010897624 6:81383873-81383895 AGAGGAGTATATTCTTTTAAGGG - Intergenic
1012368483 6:98472490-98472512 AAAGTATCATATAGTTATAATGG - Intergenic
1012394343 6:98778774-98778796 AGAGGACCATAGTATTCCAAAGG - Intergenic
1014582807 6:123159746-123159768 AGAGGAAGATATTGCTCTTATGG + Intergenic
1015308524 6:131737533-131737555 TAAGGGTCATTTTGTTCTAATGG + Intronic
1016259807 6:142155021-142155043 AGAGGAAAATATTTTTCTAATGG - Intronic
1030085987 7:105816126-105816148 AGAGGGCCAAATTCTTCTAACGG + Intronic
1030459732 7:109818256-109818278 AGATAATCATATTCTTGTAAAGG + Intergenic
1033185248 7:139221322-139221344 AGAGGAACATTTTGTTAAAAGGG - Intergenic
1034839745 7:154384884-154384906 AGATGATGATATAGCTCTAAAGG + Intronic
1035838167 8:2779905-2779927 CAAGTATCATATTATTCTAATGG + Intergenic
1036235356 8:7035147-7035169 AGAGGACAAGATTCTTCTAAGGG + Intergenic
1036410352 8:8494190-8494212 AGGGGATAATATTTTTCTAGAGG - Intergenic
1037009204 8:13819703-13819725 AGAGAATCATACTGATATAAGGG - Intergenic
1039586580 8:38712291-38712313 AGAGGGTCAGATTGTACAAATGG - Intergenic
1040021334 8:42744038-42744060 AGAAGATCACAGTGTTCAAAAGG + Intergenic
1040404861 8:47089629-47089651 AGAGCATGATAATCTTCTAAAGG - Intergenic
1041831234 8:62156661-62156683 AAAGGGTCATATAGTTCAAATGG + Intergenic
1044012484 8:87011780-87011802 TGAGGCTCATATTGTTTTTATGG + Intronic
1045661970 8:104447521-104447543 AGAGTAACATATTGTTGTTATGG - Intronic
1045818376 8:106304438-106304460 AGAAGTTCATTTTGTTTTAAAGG + Intronic
1048086144 8:131182203-131182225 AAAGAATCATATTGTTAAAATGG - Intergenic
1050236827 9:3590452-3590474 AGACAACCATATTATTCTAATGG - Intergenic
1051065775 9:13100818-13100840 TGAGAATCATCTTTTTCTAATGG + Intergenic
1051120529 9:13747352-13747374 AGAGGAGCATAGTGGTCTGAGGG + Intergenic
1051175452 9:14355466-14355488 AGAGTATCATCTTGTTGTATTGG - Intronic
1052591106 9:30496815-30496837 TGAGGATTATCTTTTTCTAAAGG + Intergenic
1052781636 9:32786954-32786976 AGAGAATCATATTTTTATAATGG + Exonic
1052786719 9:32835090-32835112 TGAGGGTCTTATTGTTCTTAAGG - Intergenic
1055193427 9:73556512-73556534 AGAGATTCAAATTGTTCTTAAGG - Intergenic
1055495836 9:76854500-76854522 TAAGTATCATTTTGTTCTAAGGG + Intronic
1057554187 9:96074324-96074346 AGAGGAATATATTGTCCTAAAGG + Intergenic
1059986003 9:119821263-119821285 AGAGGAGCATAAGGTTCTACTGG + Intergenic
1188536922 X:31207218-31207240 AGAGTATGATATTTTTCTTACGG - Intronic
1188721500 X:33528477-33528499 AGAGGAGCACATTGTCCTGAAGG - Intergenic
1194171358 X:90587462-90587484 AAAGAATCATATTGTTAAAATGG + Intergenic
1194323170 X:92477488-92477510 AGAGGAGCCCATTGTTCTGAAGG - Intronic
1195561243 X:106286711-106286733 AAATCATCAGATTGTTCTAAAGG - Intergenic
1199508209 X:148590287-148590309 TGAAGATCATATTGCTCAAAGGG + Intronic
1200517590 Y:4165216-4165238 AAAGAATCATATTGTTAAAATGG + Intergenic
1200631267 Y:5590645-5590667 AGAGGAGCCCATTGTTCTGAAGG - Intronic