ID: 1120129530

View in Genome Browser
Species Human (GRCh38)
Location 14:80788712-80788734
Sequence AGTAGGGTAAGGGGCAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129530_1120129538 6 Left 1120129530 14:80788712-80788734 CCTCTCTTGCCCCTTACCCTACT 0: 1
1: 0
2: 4
3: 40
4: 392
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129530_1120129541 21 Left 1120129530 14:80788712-80788734 CCTCTCTTGCCCCTTACCCTACT 0: 1
1: 0
2: 4
3: 40
4: 392
Right 1120129541 14:80788756-80788778 AATTTAGGCTATTTTACTTATGG 0: 1
1: 0
2: 3
3: 17
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129530 Original CRISPR AGTAGGGTAAGGGGCAAGAG AGG (reversed) Intronic
900013270 1:133445-133467 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
900043335 1:489432-489454 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
900064772 1:724429-724451 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
901794508 1:11672676-11672698 AATAGGGAAAGGGGCAGGGGAGG - Intronic
901884626 1:12214416-12214438 AGTAGAGTAGGGGGCACAAGTGG - Intergenic
902414474 1:16230782-16230804 AGTAGGCTAAGGAGGATGAGGGG - Intergenic
902683756 1:18062202-18062224 AGTAGGGTAAGTGGCCAGAGAGG - Intergenic
903128794 1:21264984-21265006 AGTAGGGCATGGGGCCAGAGAGG - Intronic
903325229 1:22565414-22565436 AGTAGGAAAGGGGGCAAGATTGG + Intronic
903589133 1:24440981-24441003 AGTAAGGGAAGGGGAAAGTGAGG - Intronic
904213124 1:28898725-28898747 AGGCGGGCAAGGGGCAGGAGGGG - Intronic
905238654 1:36567946-36567968 GGAAGGGTAAGGGACAAGAGTGG - Intergenic
905274009 1:36805498-36805520 AGCAGGGGCAGGGGCAGGAGAGG + Intronic
905324645 1:37142342-37142364 AGTAGGGTAAGGGAGGAGAGAGG + Intergenic
906158073 1:43625825-43625847 TGGAGGGCAGGGGGCAAGAGGGG - Intergenic
906337703 1:44948323-44948345 AGTAGGGGACAGGGCAGGAGAGG - Intronic
907236522 1:53054141-53054163 AGGAGGACAAGGGGCCAGAGAGG + Intergenic
907278381 1:53329131-53329153 GGGAGGTGAAGGGGCAAGAGGGG - Intergenic
907912582 1:58839946-58839968 GTTGGGGTGAGGGGCAAGAGAGG + Intergenic
908267128 1:62390386-62390408 GGTAGGGTAGGGAGCAACAGAGG + Intergenic
909666176 1:78135339-78135361 GGTTGGGTAGGGGGCAAGGGTGG + Intronic
912240134 1:107897875-107897897 TGTAGGGAAAAGAGCAAGAGGGG - Intronic
912359203 1:109080902-109080924 AGTAGGATAAGGAGGAGGAGAGG + Intergenic
912863611 1:113237151-113237173 AAAAGGGGAAGGGGAAAGAGAGG - Intergenic
912870002 1:113294964-113294986 AGAGGGGAAAGGGGCAAGATTGG - Intergenic
913027007 1:114854080-114854102 AGTAGGGAAAGAGGGGAGAGAGG - Intergenic
915445113 1:155970136-155970158 AGTTGGGTAAGGAGCAATAGAGG - Intronic
916332092 1:163628378-163628400 AGGAGGGGAAGGGGGAGGAGGGG - Intergenic
916338291 1:163698029-163698051 ACTTGGGAAGGGGGCAAGAGAGG + Intergenic
917477787 1:175383836-175383858 AGGAGGGTGAGGGGAAAGAAGGG - Intronic
918010608 1:180583096-180583118 AGAAGGCTGAAGGGCAAGAGAGG - Intergenic
918407138 1:184222521-184222543 TGAGGGGTAAGGGGCCAGAGTGG - Intergenic
919321750 1:196049801-196049823 AGTATGTTATGGGGGAAGAGAGG - Intergenic
920260929 1:204687142-204687164 TGGAGGGTAGGGGGCAAGGGAGG + Intergenic
920373969 1:205496934-205496956 AGGAAGGAAAGGGGAAAGAGAGG + Intergenic
920506659 1:206519983-206520005 AGTAAGGGAGGGGGAAAGAGAGG - Intronic
921636375 1:217499411-217499433 AGAAGGGCAAGGGGCTAGAAAGG + Intronic
922261708 1:223949943-223949965 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
922735374 1:227975803-227975825 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
924100917 1:240601982-240602004 AGTAGGCAGGGGGGCAAGAGAGG - Intronic
924342873 1:243052117-243052139 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1062986228 10:1771774-1771796 AGTATGGTCTGGGGCATGAGAGG + Intergenic
1063346784 10:5319073-5319095 AAAAGGGTAAGGGGCAGGAAAGG + Intergenic
1063881636 10:10538006-10538028 AGGAGGGTTATGGGCAAAAGGGG + Intergenic
1064362279 10:14677076-14677098 AGGAGGGAAAGGGGCAGGATTGG - Intronic
1065959760 10:30725118-30725140 AGTAGGTGAAGGGGAAAGAGTGG - Intergenic
1066126722 10:32348830-32348852 ACTGTGGGAAGGGGCAAGAGTGG + Intronic
1066589302 10:36976249-36976271 AGAAGGGTAATGGGGAAGGGAGG + Intergenic
1066630030 10:37450155-37450177 AGAAGGCTGAAGGGCAAGAGGGG + Intergenic
1066733610 10:38453437-38453459 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1068460929 10:57327266-57327288 AGAAAGGTAAGGGGAGAGAGAGG - Intergenic
1068891006 10:62148385-62148407 TGTAGGGCAAGGGGTAATAGAGG - Intergenic
1068896142 10:62203928-62203950 AGTTGGGTAAGAGGCAAGAAAGG - Intronic
1070207080 10:74274656-74274678 AGTAGGCTAAGGAGGAGGAGGGG + Intronic
1071036542 10:81253580-81253602 ATAAGGGTCAGGGGAAAGAGAGG + Intergenic
1071971904 10:90916077-90916099 AGGAGGGGGAGGGGGAAGAGTGG + Intronic
1072294574 10:93996522-93996544 AGTAGGGAATGGAGAAAGAGAGG + Intronic
1073187849 10:101627515-101627537 AGTGGGGTGGGGGGCAAGAATGG - Intronic
1073215294 10:101832861-101832883 AGATGGGAAAGGGGGAAGAGAGG - Intronic
1073513798 10:104059788-104059810 AGCAGGGTAGTGGGCAAGGGCGG - Intronic
1073565075 10:104527999-104528021 AGGAGGGCAAGGGGCAAGTGAGG + Intergenic
1074495396 10:113975824-113975846 AGTAGGGGAAGGGGGAAGGGAGG + Intergenic
1075057304 10:119229155-119229177 TGGAGAGTAAGGGGCAAGAATGG + Intronic
1075079591 10:119374392-119374414 AATAGGCTAAGAGGCAAGCGAGG + Intronic
1075303671 10:121348501-121348523 GGTGGGGCAAGGGGGAAGAGGGG - Intergenic
1075740388 10:124692327-124692349 ACTGGGGTAGGGGACAAGAGTGG + Intronic
1076008317 10:126966012-126966034 AGAAGGGTAGGGGGGAAGTGGGG - Intronic
1076969606 11:125649-125671 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1077489120 11:2852463-2852485 AATAGGGCCAGAGGCAAGAGCGG - Intergenic
1078392084 11:10944084-10944106 AGTAGGAGAAGGGGCTAGAGAGG - Intergenic
1078720085 11:13876128-13876150 AGAGGGGTGAGGGGCAAGGGTGG + Intergenic
1079027949 11:16963573-16963595 ACTGGGGAGAGGGGCAAGAGGGG + Intronic
1079492204 11:21001486-21001508 AGCAGGCTAAGGGGCATGAATGG + Intronic
1081199357 11:40198021-40198043 AGTAGGATAAGTGGGAAGATGGG + Intronic
1081568457 11:44275172-44275194 AGTTGGGACAGGGGCATGAGGGG + Intronic
1082028278 11:47587975-47587997 AGCAGGGCAGGGAGCAAGAGTGG - Intronic
1083633705 11:64108956-64108978 AGGAGGCTGAGGGGCAAGTGGGG + Intronic
1083966599 11:66047475-66047497 AGTGGGGAAAGGCCCAAGAGTGG - Intronic
1084157624 11:67322992-67323014 AGGAGGGAAAGAGGGAAGAGAGG - Intronic
1084563591 11:69917560-69917582 AGAAGGGGAGGGGGCCAGAGAGG - Intergenic
1084783825 11:71430045-71430067 GTTTGGGAAAGGGGCAAGAGTGG + Intronic
1084787603 11:71452705-71452727 AGGAGTGAAAGGGGCAGGAGAGG + Intronic
1085798004 11:79561372-79561394 TGCAGGGTCAGGGACAAGAGGGG + Intergenic
1086284012 11:85224246-85224268 TGTAGGGTAAGAAGCAACAGGGG + Intronic
1086981913 11:93207471-93207493 AGAAGGGTAAAGGAGAAGAGAGG - Intergenic
1087008168 11:93489018-93489040 AGAGGGGTCAGGGGCAAGATTGG + Intronic
1087218783 11:95523205-95523227 TGTAGGGTAATGGTTAAGAGAGG + Intergenic
1087813930 11:102637853-102637875 AGCAGGGTAAGTGGGAAAAGAGG - Intergenic
1088629764 11:111763470-111763492 AGTCGGGTGAGAGGCAAGAGTGG + Intronic
1091565146 12:1642665-1642687 AGCAGGGGAAAGGGGAAGAGTGG - Intronic
1091750955 12:3020942-3020964 AGGAGGGAAAGAGGGAAGAGGGG - Intronic
1091919689 12:4294281-4294303 AGGAGGGAAGGGGGCAAGGGAGG + Intronic
1092253239 12:6913076-6913098 GGTAGGGGAAGAGGCAAGAGGGG + Intronic
1093484881 12:19641756-19641778 AGTATGGGAAGAGGCAAGAGTGG - Intronic
1094714094 12:32994498-32994520 GGTGCTGTAAGGGGCAAGAGAGG + Intergenic
1096137814 12:49217170-49217192 AGTAGGGGGAGGGGCAAGCATGG + Intronic
1096684158 12:53276883-53276905 CCTAGGGCAAGGAGCAAGAGTGG - Intronic
1097263096 12:57730716-57730738 AGAGGGGTAAGAGGGAAGAGGGG - Intronic
1099370985 12:81829627-81829649 AGGAGGGTAAGAGGTCAGAGAGG - Intergenic
1101106638 12:101446892-101446914 AGTAGTGAAAGGGGGAAAAGAGG - Intergenic
1101748375 12:107561775-107561797 AGTAGCTTAAGGAGTAAGAGGGG - Intronic
1102298308 12:111753915-111753937 GGTAGGGGCAGGGGCACGAGGGG + Exonic
1102390345 12:112544478-112544500 AGTGGGGGTAGGGGAAAGAGGGG + Intergenic
1102932949 12:116876531-116876553 AGCAGGGGAAGGGGAGAGAGGGG - Intronic
1106002842 13:25740511-25740533 AGCAGGGTAAGTGGAAATAGTGG + Intronic
1106920053 13:34553535-34553557 AGTAGGGGAAAGGGAGAGAGTGG - Intergenic
1107126932 13:36856224-36856246 AGCAGGTGAAGGGGCCAGAGTGG + Intronic
1107633623 13:42369349-42369371 AGAAGTGTAACGGGCAAGAGAGG - Intergenic
1108287156 13:48919810-48919832 AGTGGGGGAAGCAGCAAGAGAGG + Intergenic
1108404000 13:50081676-50081698 AGTAGGGTTAGGGGCAACTTGGG - Intergenic
1108724998 13:53170978-53171000 AGTAGGGTGAGGGGGAAGATTGG + Intergenic
1108868180 13:54947733-54947755 AGTAGGGGAAGGAGAAAGGGAGG - Intergenic
1109144651 13:58764063-58764085 GGAAGGAGAAGGGGCAAGAGAGG + Intergenic
1109240159 13:59876845-59876867 AACAGGGTGAGGGGCAAGATAGG - Intronic
1109261359 13:60148885-60148907 AGTCTGGTATGGGGAAAGAGAGG - Intronic
1110382006 13:74863341-74863363 AGAAGAGCAAGGGGCAAAAGAGG + Intergenic
1110882316 13:80587314-80587336 AGCATGGTAAGGGGGTAGAGCGG + Intergenic
1110983839 13:81938618-81938640 ATCAGGGTACAGGGCAAGAGAGG - Intergenic
1112626568 13:101111458-101111480 AGAAGGAGGAGGGGCAAGAGGGG - Intronic
1112651403 13:101402828-101402850 AGTAGGGTCTGGGACATGAGAGG - Intronic
1113724240 13:112586642-112586664 AGTAGGGTAAAGGAATAGAGAGG - Intronic
1115834027 14:37377275-37377297 AGTAGGGGAGGAGGAAAGAGGGG + Intronic
1115913698 14:38285744-38285766 AGGAAGGAAGGGGGCAAGAGAGG + Intergenic
1116624274 14:47244901-47244923 AGTAGGCTGAGGAGGAAGAGAGG - Intronic
1117335959 14:54757731-54757753 AGGAGGGGAAGGGAAAAGAGAGG - Intronic
1118548576 14:66922781-66922803 AGTAGGAGGAGGGGAAAGAGGGG - Exonic
1119293874 14:73517707-73517729 GGGAGGGGAAGGGGGAAGAGAGG + Intronic
1119900345 14:78254304-78254326 AGTTGGGTATGGGGGAAGATGGG - Intronic
1119986361 14:79142542-79142564 AATTGGGTGAGTGGCAAGAGTGG + Intronic
1120129530 14:80788712-80788734 AGTAGGGTAAGGGGCAAGAGAGG - Intronic
1121217776 14:92262140-92262162 AGGAGGGTAAGGGGTAAGGTAGG - Intergenic
1121324014 14:93009397-93009419 AGTTGGGACAGGGGCAGGAGAGG - Intronic
1121731322 14:96189186-96189208 AGGAGGGGAAGGGGCAAATGTGG + Intergenic
1121963830 14:98286163-98286185 AGAAGGCCAAAGGGCAAGAGAGG + Intergenic
1121999541 14:98635579-98635601 AATAAGATAAGGGGCAGGAGGGG - Intergenic
1122901030 14:104782436-104782458 AGCAGGGTCAGGGGCAAGGCTGG - Intronic
1124389429 15:29240542-29240564 AGAAGGTGAAAGGGCAAGAGAGG - Intronic
1125042607 15:35208753-35208775 AGAGGGGTATGGGGAAAGAGAGG - Intergenic
1125510128 15:40288300-40288322 AGGAGGGTTCGGGGCTAGAGTGG + Exonic
1125551492 15:40548326-40548348 AGTAGGGAGAGGGGCAAAATTGG - Intronic
1125672395 15:41483633-41483655 AGAAGGAAAAGGAGCAAGAGAGG - Intergenic
1125697517 15:41651704-41651726 AGAAGGGGAAGGGGTAAGAGAGG - Intronic
1126016227 15:44353795-44353817 GGAAGGGTAAGGGGGAAGTGGGG + Intronic
1128096171 15:64957965-64957987 AGTAGGATAATGGGGAACAGTGG + Exonic
1129758275 15:78111816-78111838 AGGAGTGTAAGGGGGAAGAGTGG - Intronic
1130089376 15:80807172-80807194 AGTAGGGAAAGGGGCATTTGAGG + Intronic
1130918355 15:88323708-88323730 ATTAGGGTAAGAGGCCTGAGAGG + Intergenic
1130924427 15:88374670-88374692 AGTGGGCTACGTGGCAAGAGAGG - Intergenic
1131530825 15:93190376-93190398 AGGAAGGTAAGGGGAAGGAGAGG - Intergenic
1131817855 15:96240755-96240777 AGTGGGGTAAGGGTAGAGAGTGG - Intergenic
1131871915 15:96772461-96772483 AGTAGGGCAAGGGGCAATGATGG + Intergenic
1132732209 16:1367995-1368017 AGTGGGGCAAGGGGCAGGCGTGG - Intronic
1134054411 16:11160500-11160522 AAGAGGGAAAGGGGCAAGTGAGG - Intronic
1134114202 16:11535956-11535978 ACCTGGGTAGGGGGCAAGAGAGG + Intergenic
1134611025 16:15607850-15607872 AGTAGGCTTAGGAGCAAGCGAGG - Intronic
1134643946 16:15851567-15851589 AGTAGGGTCAGGGGCAAGAAAGG - Intronic
1135888371 16:26334442-26334464 AATAGTGAAAGGGGGAAGAGAGG - Intergenic
1136535384 16:30896438-30896460 AGTGGGGGAAGGGGCCCGAGGGG - Intergenic
1136670166 16:31849454-31849476 CCTAGGGGAAGGGGAAAGAGAGG + Intergenic
1137237915 16:46630358-46630380 AGTTGGGGAAGGGGAAGGAGGGG - Intergenic
1138181223 16:54941423-54941445 AGTAGGGTAAGGGGTTAGTGAGG + Intergenic
1138202742 16:55102108-55102130 AGGAGGGAAGGGGGCATGAGTGG - Intergenic
1139032851 16:62906330-62906352 AATAGGGTAGTGGGAAAGAGAGG + Intergenic
1139284106 16:65795606-65795628 GGGATGGTAAGGGGAAAGAGCGG - Intergenic
1139375540 16:66494227-66494249 AGCAGGGCACGGGGGAAGAGTGG + Intronic
1139635181 16:68254189-68254211 AGTAGGGTCACGGGGGAGAGGGG + Intronic
1139900430 16:70323778-70323800 AGCAGGGTAGGGGGTAAGAGTGG - Intronic
1141173359 16:81704508-81704530 AGGAGGGTGAGGGGAAAGAGAGG - Intronic
1142451073 16:90173473-90173495 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1142456490 17:60222-60244 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1143220246 17:5255503-5255525 AGAAGGGGAAGGGAGAAGAGGGG + Intergenic
1143479514 17:7220314-7220336 AGTAGGGGAAAGGGCAAGCCAGG + Intronic
1143576088 17:7794199-7794221 AGGAGGGGAGAGGGCAAGAGAGG - Intronic
1143604746 17:7976261-7976283 AGTAGGGGAAGAAGCAAGACTGG + Intergenic
1143905859 17:10208628-10208650 AGAAGGGAAAGGGGCGAGAGAGG + Intergenic
1145297244 17:21601394-21601416 AGTGGGGAAAGGGGATAGAGAGG + Intergenic
1146442821 17:32912121-32912143 AATACGGAAATGGGCAAGAGAGG + Intergenic
1147755311 17:42763316-42763338 TGTGGGGGAAGGGGCAAGGGAGG + Intergenic
1148319822 17:46741027-46741049 TGTGGGGGCAGGGGCAAGAGTGG + Intronic
1148742819 17:49902299-49902321 AGGAGGGTGAGGGGCAGGAGAGG + Intergenic
1149982040 17:61318482-61318504 ATTAGGGGGAGGGGGAAGAGGGG - Intronic
1150072525 17:62163956-62163978 GGTAGGTGAAGGGGCAAGGGTGG - Intergenic
1150814427 17:68381684-68381706 AGGAGGGCAAGGGGCAAGATCGG - Intronic
1150921226 17:69485665-69485687 AGAAGGAAAAGGGGCAAAAGCGG - Intronic
1151094780 17:71484335-71484357 ACAAGGGAAAGGGGCAATAGGGG + Intergenic
1151660616 17:75516310-75516332 AGGAGGGCTAGGGGCAAAAGAGG + Intronic
1152447463 17:80354182-80354204 CGTGGGGGCAGGGGCAAGAGGGG - Intronic
1153370180 18:4306503-4306525 AGGAGGGAAAGGGGAAGGAGTGG + Intronic
1153459282 18:5315979-5316001 AGTAGGGTGAGGAAAAAGAGAGG - Intergenic
1154473749 18:14730987-14731009 ACTAGGGAAAGGGGAAAGGGTGG - Intronic
1155846643 18:30716230-30716252 AGTAGAAAGAGGGGCAAGAGAGG + Intergenic
1155884208 18:31187424-31187446 AATAGGGAAAGGGGGAAGAAAGG - Intergenic
1156322840 18:36044131-36044153 AATAGGCTAAGGAGGAAGAGGGG + Intronic
1156380868 18:36559903-36559925 AGAAAGGTAAGGGTCAAGAGTGG - Intronic
1156691503 18:39712611-39712633 AGTAGGGTAAGGGCCAATGAAGG + Intergenic
1158586267 18:58738102-58738124 AGTGGGGGAAGGGAGAAGAGGGG - Intronic
1158629301 18:59098398-59098420 AGAAGGGTATGGGGCAAGGGAGG + Intergenic
1158649003 18:59270109-59270131 AGTAGAGTAATTGGCAAGAATGG + Intronic
1159182409 18:64925491-64925513 AGGAGGCTGAGGGGTAAGAGAGG + Intergenic
1160191879 18:76721507-76721529 AGTAGGGGCAGGGGGAAGATGGG + Intergenic
1160646411 19:195575-195597 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1160908066 19:1461011-1461033 GGTGGGGTGAGGGGCAAGTGTGG - Intronic
1166173622 19:41049867-41049889 AGAAAGGTAAGGAGCAAGATGGG + Intergenic
1166774232 19:45302767-45302789 AGGAGGGGAAGGGGCCAGGGAGG + Exonic
1167836055 19:52070946-52070968 AGGAGGACAAAGGGCAAGAGGGG + Intronic
1168255730 19:55164055-55164077 GGCAGGAAAAGGGGCAAGAGAGG - Intronic
1168283209 19:55317007-55317029 AGGAGGGTAAGGGGCACCAGAGG + Intronic
925333998 2:3079838-3079860 AGTAGAAAAAGAGGCAAGAGAGG + Intergenic
925654222 2:6127743-6127765 AGTTGGGTAAAGAGAAAGAGTGG + Intergenic
925763372 2:7208117-7208139 AGCAGGGACAGGGGGAAGAGAGG - Intergenic
926010009 2:9400205-9400227 AGGAGGGGAGGGGGCAGGAGGGG - Intronic
926010017 2:9400220-9400242 AGGAGGGGAGGGGGCAGGAGGGG - Intronic
927271699 2:21217217-21217239 AGAAGTGTAAGAGGAAAGAGGGG + Intergenic
928115354 2:28542200-28542222 ATTGGGGTAAGGTGGAAGAGGGG - Intronic
928284752 2:29980097-29980119 AGGAGAATAAGGGGCAGGAGAGG + Intergenic
928910628 2:36417226-36417248 AGTAGGGGAAGAGAGAAGAGGGG - Intronic
928916965 2:36482707-36482729 AATAGGGTAAGGGCCAACACTGG - Intronic
930369556 2:50485902-50485924 AGTAGGGCAAAGGGCAAGTTCGG - Intronic
932817576 2:74874193-74874215 AGTAGTATAAGAGGGAAGAGGGG + Intronic
935105977 2:100044143-100044165 AGTAGGGTAAGGTGCAGAAGAGG - Intronic
935337374 2:102029200-102029222 AGCAGGGTGAGGGGACAGAGAGG - Intergenic
936248011 2:110845263-110845285 AGAAGGGAGAGGAGCAAGAGGGG + Intronic
937622332 2:124003018-124003040 AGTATTGTAAGGGACAGGAGAGG - Intergenic
937972402 2:127560706-127560728 TGTAGGGCATGGGGCAAGGGTGG - Intronic
938858225 2:135338504-135338526 AGTTGGGTCAGGGGCATCAGAGG + Intronic
939083961 2:137695210-137695232 AGTGGGGTAAGAGGCAGCAGTGG - Intergenic
939084189 2:137697402-137697424 AGTGGGGTAAGAGGCAGCAGTGG - Intergenic
939119097 2:138094319-138094341 AGAAGGCTAAGGGGCAAAAGAGG + Intergenic
939761440 2:146186715-146186737 AGGAAGGAAAGGGGCAAGGGAGG + Intergenic
940317990 2:152345190-152345212 AATAGGGAACAGGGCAAGAGAGG + Intronic
941809189 2:169738862-169738884 GGGAGGGGAAGGGGGAAGAGAGG - Intronic
943183829 2:184578841-184578863 AGTATGGAAAGGGGCAAGAAAGG + Intergenic
946398215 2:219454045-219454067 GGGAGGGGAAGGAGCAAGAGAGG - Intronic
946601319 2:221363152-221363174 ATCAGGGTAAGGGACAAGAATGG - Intergenic
947042777 2:225942490-225942512 AGAAGGGGAAGAGGGAAGAGGGG + Intergenic
947556538 2:231098536-231098558 AGAAGAGAAAGGGGAAAGAGAGG - Intronic
948176678 2:235949070-235949092 AGAAGGGGCTGGGGCAAGAGAGG - Intronic
948223410 2:236290858-236290880 AGCAGGGGAAGGGTGAAGAGGGG + Intergenic
948742009 2:240054345-240054367 AGGAGGGGCAGGAGCAAGAGAGG - Intergenic
1169968755 20:11246412-11246434 AGTAGGGGAGGGGGCAGGAAGGG + Intergenic
1170041671 20:12045420-12045442 AGGAGGGGAGGGGGCAGGAGGGG - Intergenic
1170902246 20:20475766-20475788 AGAAGGGTAGGGGAGAAGAGGGG + Intronic
1171317448 20:24207444-24207466 AGGAGGGTCTGGGGGAAGAGGGG - Intergenic
1172753268 20:37266098-37266120 CCTAGGGCAGGGGGCAAGAGTGG - Intergenic
1173071683 20:39774317-39774339 GGCAGGGTCTGGGGCAAGAGAGG - Intergenic
1173902516 20:46601255-46601277 CGTAGGGAAAGGGGCAAAAATGG + Intronic
1175091268 20:56506528-56506550 AGTAGGGGAAGTGCCAAGAGGGG - Intronic
1175113775 20:56667313-56667335 AGTTGGGGAGAGGGCAAGAGTGG - Intergenic
1175294509 20:57899167-57899189 ATTAGGGTAAGGAGCTGGAGGGG - Intergenic
1176119381 20:63447110-63447132 AGAAGGGGCAGGGGCCAGAGTGG - Intronic
1176279100 20:64290641-64290663 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1177057110 21:16319594-16319616 AGAAGGGGAAGGGACAAGGGAGG - Intergenic
1179972073 21:44841586-44841608 GCTGGGGTGAGGGGCAAGAGGGG + Intergenic
1180699734 22:17774630-17774652 AGTCGCGTAAGGGGTAAGGGTGG - Intronic
1181317298 22:21978954-21978976 GGGAGGGTGAGGGGCAAGAGAGG + Intronic
1181317587 22:21980754-21980776 AGTAGACTAAGGGGGAAAAGTGG - Intronic
1181939058 22:26461497-26461519 GGTAGGGTGAGGGGCAGCAGGGG - Intronic
1181964839 22:26649248-26649270 TGGTGGGTAAGGGGCAAGGGTGG + Intergenic
1182737929 22:32544422-32544444 AGTGGGTTGAGGGGCAAGTGGGG - Intronic
1182956104 22:34428196-34428218 AGGAGGGAAAAGGTCAAGAGTGG - Intergenic
1183718128 22:39546201-39546223 GGTAGGGGAAGGTGCAAGTGTGG - Intergenic
1183848410 22:40562597-40562619 AGGAGGGGAAGGGGTAAGGGGGG + Intronic
1183909677 22:41069041-41069063 AGGATTGAAAGGGGCAAGAGTGG - Intergenic
949867040 3:8554951-8554973 GGTTGGGGAAGGGGCAAGACGGG - Intronic
949875737 3:8625013-8625035 AGCAGGGTAAGGGGCAGGGAGGG - Intronic
950730533 3:14952775-14952797 AGTGGGATATGGGGAAAGAGTGG - Intronic
953365434 3:42340483-42340505 AGGAGGGGAAGGGGGAGGAGGGG + Intergenic
953598424 3:44338829-44338851 AGAACTGTAAGGAGCAAGAGGGG + Exonic
954683926 3:52360434-52360456 AGTGTGGGAAGGAGCAAGAGGGG - Intronic
954956358 3:54522669-54522691 AGGAGGCTGAAGGGCAAGAGAGG + Intronic
955121254 3:56060813-56060835 AGTAGGGGCAGGGGCAGAAGAGG - Intronic
955591951 3:60546530-60546552 AGTAGAGTAAGTGGGGAGAGAGG - Intronic
955942826 3:64162999-64163021 AATGAGGTAAGGGGCTAGAGGGG - Exonic
959205196 3:103298306-103298328 AAGAGGGGAAGGGGCAAGAGAGG - Intergenic
959780332 3:110224233-110224255 AGTAGGGCAAGTGCTAAGAGAGG + Intergenic
960424719 3:117492442-117492464 AGGAAGGTAAAGGGGAAGAGAGG - Intergenic
961471461 3:127115755-127115777 AGTGGGGACAGGGGCAAGAAGGG + Intergenic
963364680 3:144320174-144320196 TGTGGGGTGGGGGGCAAGAGAGG - Intergenic
963790440 3:149577597-149577619 AGTTTGCTAAGGGGCAAGAAAGG + Intronic
966016126 3:175139942-175139964 AGTAGGGTAATGGACAAAAAAGG + Intronic
968371270 3:198223951-198223973 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
968949635 4:3683856-3683878 AGCAAGGAAAGGGGCATGAGTGG - Intergenic
969071729 4:4544872-4544894 AGTAGGCTGAGGAGCAGGAGGGG - Intergenic
969383115 4:6820590-6820612 AGTAGGATAAAGGCCAGGAGTGG - Intronic
969680832 4:8642495-8642517 AGTAGGATAAGGACCAGGAGTGG - Intergenic
970338845 4:15083500-15083522 AGTGGGGTATGTGGCATGAGGGG - Intergenic
971482841 4:27129388-27129410 AGGAGGGGAAGGAGCAGGAGGGG + Intergenic
972033499 4:34492637-34492659 AGAAGAGTAAGGAGCAAAAGGGG - Intergenic
972062491 4:34894735-34894757 AATAAGGTAAGGGGAAAGAGAGG - Intergenic
972087590 4:35239650-35239672 AATAGGCTAAAGAGCAAGAGTGG - Intergenic
972692709 4:41415397-41415419 AGGAGGGGAGGGGGCAAGAGAGG - Intronic
973826016 4:54708369-54708391 AGTAGGGGAAGAGGCATGGGAGG + Intronic
974880282 4:67748065-67748087 ACCAGGGCCAGGGGCAAGAGAGG - Intronic
976321866 4:83725496-83725518 AGGAGGGAAGGGGGAAAGAGGGG - Intergenic
976782250 4:88773923-88773945 AGTAGGATAAGGAGCCACAGAGG - Intronic
977054604 4:92175516-92175538 AGTCGGGAAAGGGGAAAGGGTGG + Intergenic
979073597 4:116241904-116241926 GCTAGGGAATGGGGCAAGAGTGG + Intergenic
979259955 4:118636424-118636446 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
979328424 4:119404202-119404224 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
980909589 4:138981999-138982021 AGTAGGGGCAGGAGCAGGAGAGG + Intergenic
981007732 4:139893036-139893058 TGTAGGGTAAGGGAGAAGAGGGG - Intronic
981928379 4:150164368-150164390 AGTAGGGTATGGGGGTAGGGGGG - Intronic
982677622 4:158394262-158394284 GGTAGGGGAAGTGGTAAGAGAGG - Intronic
982806313 4:159769223-159769245 AGTGGGGAAAGGGGAAAGTGGGG - Intergenic
983222156 4:165053795-165053817 GGGAGGGGTAGGGGCAAGAGAGG - Intergenic
983257191 4:165413157-165413179 GGTAGAGTAAGAGGGAAGAGGGG - Intronic
984759100 4:183348549-183348571 AGGAGGGTGAGGGGAAAGACAGG - Intergenic
987207517 5:15642731-15642753 AGCAGGGTAGGTGGGAAGAGGGG + Intronic
987896087 5:23949343-23949365 AGAAGGGGAAGGGGAAGGAGAGG - Intergenic
988966662 5:36425546-36425568 AGTAGGGCAAGGGGTGGGAGCGG + Intergenic
989530614 5:42503705-42503727 AATAGGGTAAGGGGCTAGGTGGG + Intronic
989609231 5:43275647-43275669 TGTTGGGAATGGGGCAAGAGAGG + Intronic
990951776 5:61305486-61305508 TCTAAGGTAAGTGGCAAGAGGGG + Intergenic
991650622 5:68848808-68848830 AGGAGGGTAAGGGGGAATATAGG - Intergenic
992106498 5:73452301-73452323 AGTAGGGGAAGGGGCGAGTAGGG + Intergenic
994809969 5:104503656-104503678 AGTAGGGAATGGGGAGAGAGAGG - Intergenic
994867608 5:105296994-105297016 ATGTGGGTATGGGGCAAGAGGGG + Intergenic
995294804 5:110507184-110507206 TATAGGGGAAGGGGAAAGAGAGG + Intronic
995816437 5:116174293-116174315 AGTAGAGTATGTGGGAAGAGAGG + Intronic
996349226 5:122519967-122519989 AGAAGGCTAAAGGGCAAGAGAGG + Intergenic
997630701 5:135366698-135366720 AGTAGGGTGAGGGACTACAGTGG + Intronic
998499743 5:142621850-142621872 AGTAGGGTAGAGAGAAAGAGAGG - Intronic
998765115 5:145477886-145477908 AGGAGGGAAAGGGGGAAGTGGGG + Intronic
999190604 5:149744089-149744111 GGGAGGTGAAGGGGCAAGAGAGG + Intronic
999242186 5:150134074-150134096 GATAGGGTAGGGGGCTAGAGAGG + Intronic
1000013600 5:157257429-157257451 AGAAGGGTAAAGGGCAAAAAGGG - Intergenic
1001560634 5:172666761-172666783 AGAAGGGTAAGGCCCACGAGGGG - Intronic
1001622191 5:173096510-173096532 GGAGGGGGAAGGGGCAAGAGGGG - Intronic
1002548987 5:179973100-179973122 GGTAGGGTCAGGAGTAAGAGAGG - Intronic
1002730508 5:181329497-181329519 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1002754021 6:144607-144629 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1003873598 6:10419350-10419372 AGTAGGGGAGGGGGCCGGAGCGG - Intronic
1004603520 6:17173433-17173455 AGAAGGGGAAGGGGCAGGGGAGG + Intergenic
1005062867 6:21793428-21793450 AGTAAGGTGAGGGGTGAGAGGGG + Intergenic
1006150473 6:31984201-31984223 GGGAGGGGAAGGGGCAAGGGAGG + Intronic
1006156774 6:32016939-32016961 GGGAGGGGAAGGGGCAAGGGAGG + Intronic
1006970869 6:38043562-38043584 AAGAGGGGAAGGGGGAAGAGGGG - Intronic
1007384896 6:41513876-41513898 CCTAGAGGAAGGGGCAAGAGTGG - Intergenic
1007393915 6:41566457-41566479 AGCTGGGTAAAGGCCAAGAGAGG + Intronic
1008499039 6:52161873-52161895 AGAAGGGTAAGGGGGAAGTAAGG - Intergenic
1008965219 6:57307904-57307926 AGCAGGGGAGGGGGCTAGAGTGG + Intergenic
1009671175 6:66753091-66753113 AGTAAAGTAAGGAGGAAGAGAGG + Intergenic
1011735446 6:90305705-90305727 ATTAGGGGAAGGGGCAGGAAGGG + Intergenic
1011886529 6:92103283-92103305 AGATGGAGAAGGGGCAAGAGGGG - Intergenic
1012656192 6:101824283-101824305 CTTAGGGGAAAGGGCAAGAGGGG - Intronic
1013740283 6:113275693-113275715 AGGAGGGGAAGGAGGAAGAGGGG + Intergenic
1014110870 6:117617396-117617418 CCTAGGGGAAGGGGAAAGAGAGG + Intergenic
1015235130 6:130962249-130962271 AGAAGGGGAAGAGGCAGGAGAGG + Intronic
1015324939 6:131914284-131914306 AGGAAGGTGAAGGGCAAGAGAGG + Intergenic
1015597801 6:134882186-134882208 AGCGGGGTAAGGGCCAAGACAGG + Intergenic
1015655491 6:135513658-135513680 ACTAGGGGAAGGGGGAAGTGGGG + Intergenic
1016851871 6:148628244-148628266 AGAAGGGTAAAGGGCAAGAGAGG + Intergenic
1017123491 6:151045403-151045425 AGTAGGGAAAGTGGAGAGAGGGG - Intronic
1017663490 6:156696170-156696192 AGTAGGGTACAGGGATAGAGGGG - Intergenic
1019672412 7:2288497-2288519 AGTAGGGAAAGGGAGAGGAGGGG - Intronic
1019717064 7:2543966-2543988 GGTAGGGGATGGGGGAAGAGAGG + Intronic
1020080172 7:5282658-5282680 AGGAGGGAGAGGGGGAAGAGAGG + Intronic
1021258867 7:18429058-18429080 AGCAGGGTAAGGGGAAAAGGAGG - Intronic
1021922479 7:25499923-25499945 AGGAGGTTAAGGGACAAGACTGG - Intergenic
1021971058 7:25966592-25966614 AGGAGGGAAGGAGGCAAGAGAGG + Intergenic
1022485765 7:30776466-30776488 AGTAGGATAAGGAGACAGAGAGG - Intronic
1023401679 7:39796048-39796070 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1023776829 7:43615953-43615975 AGCAGGGTGATGGGCGAGAGTGG - Intronic
1024647941 7:51384627-51384649 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1025051795 7:55739126-55739148 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1025128754 7:56364794-56364816 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic
1026171198 7:67955322-67955344 AGTAGGGGAAGGAGCAGGAGTGG + Intergenic
1027536098 7:79404319-79404341 AGTAGGAGAAGGGGAAGGAGAGG - Intronic
1028010135 7:85632319-85632341 GATAGGGTAAGGGGTAAAAGTGG - Intergenic
1028123280 7:87082132-87082154 AGAAGGGGAAGGGGCAAAATTGG + Intergenic
1028206523 7:88023819-88023841 AGGAGGGTAGGGGGGAAGTGGGG - Intronic
1029034930 7:97509422-97509444 AGGAGGGTAGTGGCCAAGAGAGG - Intergenic
1032052183 7:128656417-128656439 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1033150837 7:138913843-138913865 AGGAAGGAAAGGGGGAAGAGTGG + Intronic
1033493766 7:141872242-141872264 GGTGGTATAAGGGGCAAGAGAGG + Intergenic
1034845574 7:154441244-154441266 AGAAAGGGAAGGGGCTAGAGTGG - Intronic
1035688974 8:1547467-1547489 AGGAGGGTCTGGGGCAGGAGGGG + Intronic
1036591793 8:10174942-10174964 AACAGGGAAAGGGGCAAGATCGG - Intronic
1037548028 8:19942109-19942131 AGTCAGGTACGGGGGAAGAGCGG + Intronic
1037696046 8:21224832-21224854 AATAGAGCAAGTGGCAAGAGAGG - Intergenic
1037923277 8:22824390-22824412 TGTAGGGTTAGGGACAGGAGGGG - Intronic
1041015875 8:53592858-53592880 TGGGGGGTGAGGGGCAAGAGAGG - Intergenic
1043825190 8:84919604-84919626 AATTGGGTAAGGAGAAAGAGAGG + Intronic
1044387720 8:91609575-91609597 AATAAGGTACGGGGGAAGAGGGG - Intergenic
1044559831 8:93602019-93602041 AGTAGGGTATGGGGAAAGGAAGG - Intergenic
1045076208 8:98571371-98571393 ACAGGGGTAAGGGGAAAGAGGGG + Intronic
1045977348 8:108144802-108144824 AGTGGGGTAAGGGATTAGAGTGG + Intergenic
1046792231 8:118334478-118334500 AGGAGGGTAAGGGAGGAGAGGGG - Intronic
1046806424 8:118484085-118484107 AGTAGGGTAAGGGGAAAGGGTGG + Intronic
1047621772 8:126615079-126615101 AGATGGCAAAGGGGCAAGAGAGG - Intergenic
1049584946 8:143428721-143428743 AGCAGGGTCGGGGGCAAGCGGGG + Exonic
1050308187 9:4327334-4327356 AGTAGGGGAAGAGGGAGGAGAGG + Intronic
1050631303 9:7561575-7561597 AGTGGGGTAGGGGGCAGGTGGGG - Intergenic
1054790561 9:69252713-69252735 AGTAGGATATGGGGAAAGGGTGG + Intronic
1055874374 9:80924534-80924556 AAAAGGGGAAGGGGCAGGAGAGG + Intergenic
1056386849 9:86103930-86103952 ATTAGGGTAAGGATCATGAGAGG + Intergenic
1057637339 9:96781815-96781837 AAGAGAGAAAGGGGCAAGAGAGG + Intergenic
1057801703 9:98195113-98195135 AGGGAGGGAAGGGGCAAGAGAGG - Intergenic
1058532868 9:105924426-105924448 AGCAGGGTAAGGGGCAAGGAGGG - Intergenic
1058740387 9:107936867-107936889 AGGGGTGAAAGGGGCAAGAGTGG - Intergenic
1060146423 9:121256514-121256536 GGGAGGGTAAGGAGGAAGAGAGG + Intronic
1060551147 9:124486005-124486027 AGTAGGGGCAGGGGCGGGAGGGG + Intronic
1061429730 9:130523546-130523568 AGAAGAATAAGGGGCTAGAGAGG + Intergenic
1061695340 9:132369173-132369195 AGTAGGGGAAGGAGGAAAAGAGG - Intergenic
1062346417 9:136117318-136117340 CGGATGGGAAGGGGCAAGAGTGG + Intronic
1062349246 9:136131146-136131168 AGTAGGGAATGGGGCAGGTGGGG + Intergenic
1062754919 9:138282007-138282029 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1203578828 Un_KI270745v1:26176-26198 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1185492837 X:532022-532044 AGTGGGGTGGGGGGCCAGAGGGG - Intergenic
1185641646 X:1591999-1592021 AGTAGGGGTAGGGGCTGGAGCGG + Intronic
1186984387 X:14996415-14996437 AGTAGGGTAGGGGGCAGGGGAGG - Intergenic
1187977578 X:24718738-24718760 TGTAGGGTAATGGGGAAGTGTGG + Intronic
1188032253 X:25277096-25277118 AGTAGGGTAGTGGGTAAGAAGGG + Intergenic
1189125778 X:38444692-38444714 AGAAGGGTAATGGGGAAGGGAGG - Intronic
1189244734 X:39554718-39554740 AGCAGGGGAAAGGGCAAAAGTGG - Intergenic
1189478426 X:41374975-41374997 AACATGGTAAGGGGCGAGAGTGG - Intergenic
1190322735 X:49188075-49188097 CGCAGGGGAAGGGGGAAGAGGGG + Exonic
1190534630 X:51413580-51413602 AGAAGGGGAAGCGGGAAGAGAGG - Intergenic
1191761613 X:64653345-64653367 GGTAGTGGAAGGGGGAAGAGCGG - Intergenic
1193105064 X:77661884-77661906 AGTAGGGAAAGGAACAACAGGGG - Intronic
1193594528 X:83430199-83430221 GGGAGGGTAAGGGGGAAGTGGGG + Intergenic
1194267935 X:91778442-91778464 GGTAGGAAAGGGGGCAAGAGAGG - Intergenic
1195246299 X:102998621-102998643 AGAATGGTCAGGGGCAAGAGAGG - Intergenic
1195280032 X:103323515-103323537 ATTAGGGGAAGGGGGCAGAGGGG - Intergenic
1195877968 X:109562172-109562194 AGGAGGGTCAGGGAAAAGAGGGG - Intergenic
1198121785 X:133600666-133600688 AGAAGGGTAATGGGTCAGAGAGG + Intronic
1198188751 X:134282677-134282699 AGCAGGGTGAGGGGAAAGTGGGG + Intergenic
1199907959 X:152254230-152254252 AGTAGGGGAAGGGACATGGGAGG - Intronic
1200310796 X:155075282-155075304 AGAAGGGCCAGGGGAAAGAGTGG - Intronic
1200311519 X:155083448-155083470 AGGAGGGAAAAGGGGAAGAGAGG - Intronic
1200585141 Y:4999367-4999389 GGTAGGAAAGGGGGCAAGAGAGG - Intergenic
1200861438 Y:7996793-7996815 AGGAGGGTGAGGGGCTACAGTGG + Intergenic
1201538990 Y:15085614-15085636 AGTAGGGTAGTGGACAAGAGTGG - Intergenic
1201770858 Y:17615500-17615522 AGTGGGGGTAGGGGCAGGAGTGG - Intergenic
1201830697 Y:18290486-18290508 AGTGGGGGTAGGGGCAGGAGTGG + Intergenic
1202381451 Y:24278794-24278816 AGTAGGGGCAGGGGCAGCAGTGG - Intergenic
1202489334 Y:25391332-25391354 AGTAGGGGCAGGGGCAGCAGTGG + Intergenic