ID: 1120129531

View in Genome Browser
Species Human (GRCh38)
Location 14:80788721-80788743
Sequence GAGAGGAGAAGTAGGGTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 748}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129531_1120129541 12 Left 1120129531 14:80788721-80788743 CCCCTTACCCTACTTCTCCTCTC 0: 1
1: 0
2: 5
3: 71
4: 748
Right 1120129541 14:80788756-80788778 AATTTAGGCTATTTTACTTATGG 0: 1
1: 0
2: 3
3: 17
4: 264
1120129531_1120129538 -3 Left 1120129531 14:80788721-80788743 CCCCTTACCCTACTTCTCCTCTC 0: 1
1: 0
2: 5
3: 71
4: 748
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129531 Original CRISPR GAGAGGAGAAGTAGGGTAAG GGG (reversed) Intronic
900038500 1:435584-435606 GAGAGAAGAAGGAGAGTAAAGGG + Intergenic
900059935 1:670563-670585 GAGAGAAGAAGGAGAGTAAAGGG + Intergenic
900491763 1:2952834-2952856 GAGAGGAGATGGTGGGTCAGGGG - Intergenic
900549220 1:3245690-3245712 GAAAGGAGAAAGAGGGAAAGTGG - Intronic
900803503 1:4752200-4752222 GAGAGGAGGAGGAGGGACAGGGG + Intronic
901715836 1:11153176-11153198 GAGAGGAGTGGAAGGGGAAGGGG + Intronic
901740381 1:11338168-11338190 GAGGGGAGAAGGAGGAGAAGGGG - Intergenic
901892835 1:12282805-12282827 CAGAGGAGAATCAGGGCAAGGGG - Exonic
902217993 1:14946680-14946702 AAGAGGAGAAGTAGGTGAACGGG - Intronic
902767312 1:18626000-18626022 GAGAGGAGAAGGAAGAGAAGTGG + Intergenic
902833136 1:19030307-19030329 GAAAGGAGAAGGAGGGAAGGAGG + Intergenic
902841656 1:19078015-19078037 GAGAAGGGAAGAACGGTAAGCGG + Exonic
902919495 1:19657627-19657649 GAGATGGGAAGTGGGGTGAGAGG - Exonic
904318215 1:29679779-29679801 AAGAAGAGAAGGAGGGAAAGAGG - Intergenic
904484951 1:30818574-30818596 GAGAAGAAAAGCAGGGAAAGGGG + Intergenic
904704168 1:32377962-32377984 GGGAGGAGGAGGAAGGTAAGAGG - Exonic
904768729 1:32869671-32869693 GAGAGAACAGGTAGGGGAAGAGG + Intronic
904937886 1:34144719-34144741 GAGAGGGGAAGTAAGGGAGGGGG + Intronic
905257386 1:36693551-36693573 GAGAGGATAAGACAGGTAAGGGG + Intergenic
905313074 1:37064092-37064114 GAGAGGAGCAGAAGGGCGAGGGG + Intergenic
905362649 1:37431093-37431115 GATAGGAGAAGGAGGGGAAGGGG + Intergenic
905597575 1:39221317-39221339 GAGAGGTGATGTGGGCTAAGTGG + Intronic
905882333 1:41472451-41472473 GAGCGGGGTAGTAGGGTAAAGGG + Intergenic
906113170 1:43337999-43338021 GGGAGGGGAGGTAGAGTAAGAGG + Intronic
906529223 1:46513619-46513641 GAGAGCAGCAGCAGGGGAAGAGG + Exonic
906551652 1:46670711-46670733 ACGAGGAGAACAAGGGTAAGTGG + Intronic
907387499 1:54135714-54135736 GAGAAGAGAAGGAGGGTAGGGGG - Intronic
907569390 1:55468812-55468834 GAGAGAAGAAGGAAGGAAAGGGG + Intergenic
907957404 1:59242984-59243006 GAGAGGATAAGAAGTGTTAGGGG - Intergenic
908031654 1:60006523-60006545 GAAATGAGGAGTAGCGTAAGAGG - Intronic
908131901 1:61082699-61082721 GAGAGGAGAAAGAGGGAGAGAGG - Intronic
908264967 1:62369259-62369281 AAAAGGAAGAGTAGGGTAAGGGG - Intergenic
908779297 1:67674743-67674765 CAGAGGGGCAGTAGGGGAAGTGG + Intergenic
908819191 1:68065957-68065979 GAGAGTAGGATTGGGGTAAGTGG - Intergenic
909171534 1:72302159-72302181 GAGAGGAGGAGGAGGAGAAGAGG - Intergenic
909292832 1:73905860-73905882 GAGAGAAGAGGGAGGGAAAGGGG - Intergenic
909317556 1:74242932-74242954 AAGAAGAGATGAAGGGTAAGGGG - Intronic
909561799 1:77016065-77016087 GAGTGGAGAAGGAGGGGATGTGG - Intronic
910518684 1:88092667-88092689 GACTGGAGAAGTAGGCTGAGAGG + Intergenic
910674023 1:89799530-89799552 TAGAGGGGAGGTAGGATAAGGGG - Intronic
911196720 1:95002264-95002286 GTGGGGAGAAGTAGCGCAAGCGG + Intronic
912019007 1:105080887-105080909 GAGAGGGGAGGAAGGGTAAGAGG - Intergenic
912799965 1:112714506-112714528 GGGAGGGGAACTACGGTAAGAGG + Intronic
913109845 1:115648059-115648081 GAGAGGAGAGGGAGTGTTAGAGG + Intronic
913565367 1:120068697-120068719 GGCAGGAGAAGTAGGGCAACTGG - Intronic
913632764 1:120724865-120724887 GGCAGGAGAAGTAGGGCAACTGG + Intergenic
914244855 1:145878046-145878068 AAGGGGAGAAGGAGGGTAGGTGG + Intronic
914285955 1:146228052-146228074 GGCAGGAGAAGTAGGGCAACTGG - Intronic
914546987 1:148678805-148678827 GGCAGGAGAAGTAGGGCAACTGG - Intronic
914619520 1:149391557-149391579 GGCAGGAGAAGTAGGGCAACTGG + Intergenic
914764914 1:150629405-150629427 GCGAGGAGAAGCAGGTGAAGTGG - Exonic
915595438 1:156893996-156894018 GAGACGTGAAGGAGGGGAAGGGG + Intronic
915839119 1:159201298-159201320 GAGGGGTGAGGAAGGGTAAGGGG + Exonic
916316186 1:163450727-163450749 GAGAGGCGCAGAGGGGTAAGTGG - Intergenic
916332097 1:163628387-163628409 GGGAGGAGAAGGAGGGGAAGGGG - Intergenic
916459393 1:165007636-165007658 GTGAGGAGAAGTATGATGAGAGG - Intergenic
917013997 1:170508776-170508798 TAGAGGGGGAGAAGGGTAAGGGG - Intergenic
917144441 1:171873541-171873563 GAAAGGCAAAGCAGGGTAAGGGG + Intronic
917727248 1:177839579-177839601 GAGAGGAGAAGGTGGGAAGGGGG - Intergenic
918386884 1:184017628-184017650 TAGAGGGGAAGTTGGCTAAGTGG + Intronic
918657263 1:187043681-187043703 GAGAGAAGAAGAAGAGGAAGAGG - Intergenic
920073723 1:203321790-203321812 GAGGGGAGAAGTGGGAGAAGAGG - Intergenic
921302696 1:213765704-213765726 GAGGGGAGTAGTAGGGAGAGGGG - Intergenic
921481795 1:215672423-215672445 GAGAGGAGAACCAGGGGAGGAGG - Intronic
922101594 1:222481836-222481858 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
922262675 1:223956952-223956974 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
922302102 1:224310718-224310740 GAGAGGAGAAGGAAAGAAAGAGG - Intronic
922907751 1:229187703-229187725 ATGAAGAGAAGTAGGTTAAGGGG - Intergenic
924261855 1:242239706-242239728 GAGGGGACAAGTTGGTTAAGCGG - Intronic
924344514 1:243061953-243061975 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
924497198 1:244601987-244602009 GGAAGGAGAAGAAGGGGAAGGGG + Intronic
1062852754 10:758225-758247 GAGAGGTGAAATAAGGTAAATGG - Intergenic
1063330024 10:5148251-5148273 GAGGGGAGAAGCAGGGAAGGAGG + Intergenic
1063375352 10:5551296-5551318 GAGAGGTGAAGGAGGGCAGGAGG + Intergenic
1064114795 10:12568394-12568416 AAGAGGAGCAGGAGGGGAAGGGG - Intronic
1064563330 10:16614333-16614355 GAGAGGAGAAGGATGGTGACCGG + Intronic
1064599966 10:16983853-16983875 GAGAGCAGAACTAGGGTGATAGG - Intronic
1064818059 10:19289556-19289578 GAGAGGAGATATAAGGTTAGAGG - Intronic
1064834997 10:19516758-19516780 GGGAGGAGAAGAAGGTGAAGGGG - Intronic
1065219258 10:23479418-23479440 GAGAGGTGAGGAAGGGAAAGAGG - Intergenic
1065920753 10:30390677-30390699 TAGAGGCGAGGAAGGGTAAGGGG - Intergenic
1066686468 10:37986462-37986484 AAGAGGAGAAGGAGGCAAAGGGG - Intergenic
1066731819 10:38443119-38443141 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1068021136 10:51585974-51585996 GAGTGGGGAGGTAGGGCAAGAGG + Intronic
1068026577 10:51652870-51652892 GAGAGGAGTAGTAGGAGAAGAGG - Intronic
1069710955 10:70488481-70488503 GAGAGGGGAAGGAGGGGAAAGGG - Intronic
1070469425 10:76764075-76764097 GGGAGGAGAAGAGGGGAAAGAGG + Intergenic
1071272002 10:84016606-84016628 GAGAGGAGAACAAGAGGAAGAGG + Intergenic
1071676408 10:87659791-87659813 GGGAGGAGGAGTAGGAGAAGGGG + Exonic
1071731783 10:88255481-88255503 GGGAGGAGGAGTAGGGGTAGAGG + Intergenic
1072207169 10:93214860-93214882 GACAGGAGAAGGAGGGAAAGAGG - Intergenic
1072645612 10:97251489-97251511 GAGGGGAAAGGAAGGGTAAGGGG + Intronic
1073051863 10:100672237-100672259 GAGAGAGGAAGAAGGGGAAGAGG + Intergenic
1074006719 10:109433306-109433328 GGGAGGAGAACAAGGGAAAGGGG - Intergenic
1074495392 10:113975815-113975837 AAGAGAGGAAGTAGGGGAAGGGG + Intergenic
1075281467 10:121142458-121142480 GAGAAGAGAAGGAGGGGATGAGG + Intergenic
1075449380 10:122538810-122538832 GATATGAGAAGTAGGGGAAAAGG + Intergenic
1076964704 11:71498-71520 GAGAGAAGAAGGAGAGTAAAGGG + Intergenic
1077557231 11:3231553-3231575 GGGAGGAGAAGGAGGGGAGGAGG + Intronic
1077557254 11:3231619-3231641 GGGAGGAGAAGGAGGGGAGGAGG + Intronic
1077572806 11:3354225-3354247 GAGAGGAGATGTAGATTATGAGG + Intronic
1078770150 11:14342119-14342141 GGGAGGAGCAGTGGGGTAGGAGG - Intronic
1079350689 11:19689377-19689399 GGGAGGAAAAGTTGGGGAAGAGG + Intronic
1079354892 11:19722665-19722687 CAGAAGAAAAGAAGGGTAAGGGG + Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1080101503 11:28465292-28465314 GAAAGGACAAGAAGGGTAAGAGG - Intergenic
1081583414 11:44367725-44367747 GACAGGAGGAGTTGGGTAACAGG - Intergenic
1081633569 11:44705567-44705589 GAAAAGAGAAGCGGGGTAAGGGG - Intergenic
1083068927 11:59956158-59956180 GAGAGGAGAGGAAGGGAAGGAGG - Intergenic
1083224609 11:61276927-61276949 GAGAGGAGAAGACAGGGAAGGGG + Intronic
1083617940 11:64035721-64035743 GAGAGGAGGAGGAGGGGAGGGGG - Intronic
1084149296 11:67280813-67280835 GAGAGGAGCAGCAGGGTGCGTGG - Intronic
1084578451 11:70006448-70006470 GAGAGCAGAGGTAGGGGAGGTGG - Intergenic
1084951356 11:72667700-72667722 GAGAGGAGTAGGAGAGAAAGAGG + Intronic
1085958016 11:81424644-81424666 GAGAAGAGAAATATGGTAAAAGG + Intergenic
1089145550 11:116327348-116327370 AAGAGGAGAAGGAGAGTGAGAGG - Intergenic
1089197536 11:116703457-116703479 GTGAGGAGAAGCAGGCTCAGAGG + Intergenic
1089389601 11:118091508-118091530 GAGAGGAGGGCTAGGGGAAGGGG - Intronic
1089458411 11:118639026-118639048 GAGATTTGGAGTAGGGTAAGTGG + Intronic
1090411128 11:126510670-126510692 GAGAGAAGATGTAGGGGAATAGG - Intronic
1090484773 11:127103083-127103105 GGGAAGAGAAGTAGGTTAAAGGG + Intergenic
1090865721 11:130698872-130698894 GGGAGTAGAAGAAGGGTGAGAGG + Intronic
1091028253 11:132160874-132160896 GAGAGAAGGAGGAGGGTGAGAGG + Intronic
1091070528 11:132558442-132558464 GGGAGGACGAGTAGGGGAAGAGG - Intronic
1091309979 11:134565914-134565936 CAGAGGAGAAGTAGGCTTTGGGG + Intergenic
1091687295 12:2572560-2572582 GAGAGGAGAAGGAGGAGGAGAGG - Intronic
1091687299 12:2572577-2572599 GAGAGGAGAAGGAGGAGGAGAGG - Intronic
1091687346 12:2572794-2572816 GAGAGGAGAAGGAGGAGAGGAGG - Intronic
1091941447 12:4487261-4487283 GAGAGCAGAAATGGGGGAAGGGG + Intergenic
1093405166 12:18796357-18796379 GAGAGGGGTAGTGGGGAAAGAGG - Intergenic
1093412251 12:18880713-18880735 GAGAGGAGACGTGAGGAAAGAGG - Intergenic
1093550265 12:20401569-20401591 GAGATGAGAATTAGGGGCAGAGG - Intronic
1094291580 12:28856368-28856390 GAGAGGAGGAATTGGGGAAGGGG + Intergenic
1095131929 12:38553127-38553149 GAGAGGAGATGAAGGGAAGGGGG - Intergenic
1095265952 12:40157963-40157985 GTGAGGAGAAGGAAGGTTAGTGG - Intergenic
1095509253 12:42932003-42932025 GAGAGGAGGAGTAGGAGAAAGGG + Intergenic
1095667502 12:44819692-44819714 GAGAGGTTGAATAGGGTAAGTGG - Intronic
1096764135 12:53869160-53869182 GAGAGGGGAAGGAGGGAGAGGGG - Intergenic
1096877899 12:54644832-54644854 GGAAGGAGAGGTAGGGGAAGGGG + Intronic
1096886135 12:54721256-54721278 GAGAGGAGAAGGAGGGGGAGAGG - Intergenic
1097285772 12:57876107-57876129 AAGAGGAGAAGCAGGTTGAGGGG - Intergenic
1097288919 12:57897690-57897712 GAGAGGAGGAGTGGGGGATGAGG + Intergenic
1097332876 12:58351426-58351448 GAGAGGAGAGGATGGGTACGTGG + Intergenic
1098145150 12:67490094-67490116 GTGAGGAGAAGTAGGATCAGGGG - Intergenic
1099361164 12:81703563-81703585 AAGTGGAGAAGGAGGGCAAGAGG - Intronic
1099444282 12:82733698-82733720 GTGAAGAGAAGTAAGGTACGTGG + Intronic
1100026270 12:90132093-90132115 GAGAGGAGAAGCTGGAGAAGAGG + Intergenic
1100459434 12:94784655-94784677 GAGAGGAGACCTAGGGTGTGTGG + Intergenic
1100566754 12:95802416-95802438 GAGAGGAAAAGCAGGGTAAGAGG + Intergenic
1100734261 12:97509614-97509636 GAGGGGAGGAGAAGGGTCAGGGG - Intergenic
1101051222 12:100866105-100866127 GAGAGGATACGGAGGGGAAGTGG + Intronic
1101811048 12:108108066-108108088 GAGAGGAGAGGGAGGGTGTGGGG + Intergenic
1101843082 12:108341881-108341903 GAGAGGAGGAGGAGGGAAAGAGG + Intergenic
1102503149 12:113366779-113366801 GAGAGGAGGAGGAGGGAAGGAGG - Intronic
1102704710 12:114870938-114870960 GAGAAGAGAAGGGGGGAAAGTGG - Intergenic
1102755271 12:115334749-115334771 GACAGGAGAACAAGGGAAAGGGG + Intergenic
1102840360 12:116113726-116113748 GAGAGGAGGGGGAGGGGAAGAGG + Intronic
1103061749 12:117863888-117863910 GAGGGAAGTAGGAGGGTAAGGGG - Intronic
1103074046 12:117968271-117968293 GGGAGGAGGAGGAGGGGAAGGGG - Intronic
1103123448 12:118400070-118400092 GAGTGAAGAAGAAGGGAAAGAGG + Intronic
1103134979 12:118499374-118499396 GGGAGGGGAAGGAGGGGAAGCGG - Intergenic
1103984008 12:124755187-124755209 GAGATGGGAAGCAGGGCAAGAGG - Intergenic
1104145311 12:126027934-126027956 GAGAGAACAGGTTGGGTAAGAGG + Intergenic
1104325634 12:127793820-127793842 GAGAGGACAAATATGGTAGGTGG + Intergenic
1106014336 13:25854068-25854090 GAGAAGGGAACTAGGGTTAGTGG - Intronic
1106370485 13:29127733-29127755 CAGAGGAGAATCAGGGCAAGCGG - Intronic
1106642327 13:31597446-31597468 AAGAGAAAAAGTAGGGGAAGTGG - Intergenic
1106867046 13:33976435-33976457 ATGAGGAGAAGTTGGTTAAGAGG + Intergenic
1106947610 13:34846416-34846438 GAGGGCAGAAGTAAGGAAAGGGG - Intergenic
1106995337 13:35474871-35474893 GGGAGAAAAAGTAGGGGAAGCGG - Exonic
1108046418 13:46388223-46388245 GAAAGGAGAAGAAGGGAAGGAGG + Intronic
1109190159 13:59313957-59313979 GAGAAGGGAAGCAGGGGAAGAGG - Intergenic
1109337669 13:61013359-61013381 AAGAGGAGATGTAGGTTTAGCGG - Intergenic
1110149945 13:72239123-72239145 CTGAGGAGGAGTAGGGTAAAGGG - Intergenic
1110778304 13:79435200-79435222 GAGAGGAGGAGGAGGAAAAGAGG - Intergenic
1110982099 13:81913153-81913175 GAAAGATAAAGTAGGGTAAGAGG - Intergenic
1111157271 13:84344330-84344352 GAGAAGGGAGGTAGGGCAAGGGG + Intergenic
1111174165 13:84571637-84571659 AAGGAGAGAAGTAGGGAAAGTGG - Intergenic
1112057473 13:95703984-95704006 TGGAGGCAAAGTAGGGTAAGTGG - Intronic
1112835509 13:103509311-103509333 GAGAGGAGAAGTCAAGTGAGAGG + Intergenic
1112835514 13:103509351-103509373 GAGAGGAGAAGTCAAGTGAGAGG + Intergenic
1112879945 13:104094529-104094551 GTGAGGAGAAGCAGGCTGAGGGG - Intergenic
1113575542 13:111392770-111392792 GAGAGGCCAAGGAGGGAAAGGGG + Intergenic
1113991938 14:16034820-16034842 AAAAGGAGGAGGAGGGTAAGAGG - Intergenic
1114737567 14:25058063-25058085 GAGACAAAAAGTAGGGAAAGAGG - Intergenic
1115323379 14:32110255-32110277 GAGAGAAAAGGCAGGGTAAGAGG + Intronic
1115909191 14:38236539-38236561 GTGAGTAGAAGTAGAATAAGAGG - Intergenic
1116342541 14:43743258-43743280 GAGAAGAGAAGGAGGGGGAGAGG - Intergenic
1116797679 14:49409452-49409474 GAGATGGGAAGTTGGGAAAGAGG - Intergenic
1116987828 14:51240125-51240147 GAGTGGTGAAGTCGGGAAAGAGG - Intergenic
1117253298 14:53955349-53955371 GAGAGGATAGGAAGGGGAAGGGG + Intronic
1117467092 14:56004492-56004514 AGCAGGAGAAATAGGGTAAGTGG + Intergenic
1117649063 14:57883028-57883050 GAGGGGAGAAGGAGGAGAAGGGG + Intronic
1118038264 14:61891532-61891554 GAGAGGACAAGTAGGGCTGGAGG + Intergenic
1118135482 14:63021540-63021562 CAGAGGAGATGTAGGCTGAGTGG - Intronic
1118171815 14:63395817-63395839 GAGAGGAGGAGGAGGGGGAGGGG + Intronic
1118321694 14:64757207-64757229 GAGAGCAGAGGCTGGGTAAGAGG - Intronic
1118383040 14:65233368-65233390 GAGAGGTAGAGTAGGGTAATGGG - Intergenic
1119117869 14:72043948-72043970 GAGAGGAGGAGGAGGAGAAGCGG - Intronic
1119608679 14:76043330-76043352 GAGGGGAGTAGAAGGGTAGGTGG + Intronic
1119730407 14:76947524-76947546 GAGAGGAGAGGAAGGGGAGGGGG - Intergenic
1119883753 14:78122979-78123001 CAGAGGAAAAGGAGGGTGAGCGG + Intergenic
1120129531 14:80788721-80788743 GAGAGGAGAAGTAGGGTAAGGGG - Intronic
1120411262 14:84159071-84159093 GAGAGGGGAAGTATGGCAGGCGG + Intergenic
1121050216 14:90815522-90815544 TAGAGGAGAAATAGAGTCAGGGG - Intronic
1121124813 14:91399271-91399293 GTGAGGAGAAGTGGGCTTAGTGG - Intronic
1121235017 14:92385887-92385909 GAGGGGAGAGGTAAGGTGAGTGG + Intronic
1121777068 14:96598118-96598140 GAGAGGAGAGGAGGGGGAAGAGG - Intergenic
1121777100 14:96598218-96598240 GAGAGGAGAGGAAGGGGAAGAGG - Intergenic
1121997242 14:98612771-98612793 GAGATGGGAACCAGGGTAAGAGG + Intergenic
1122198664 14:100108658-100108680 GAGAGGGGAAGAAGGGCCAGGGG - Intronic
1122426349 14:101608140-101608162 GAGAGGAGAAGGAGGAGAGGTGG - Intergenic
1122606006 14:102948126-102948148 CAGAGGACAAGTGGGGTGAGGGG + Intronic
1123146311 14:106133919-106133941 AAGAGGAAAAGCTGGGTAAGGGG + Intergenic
1123736391 15:23188242-23188264 GAGAGGAGAAGGAAGGGGAGGGG - Intergenic
1124117256 15:26857006-26857028 GAAAGGAGAAGGAGGAGAAGAGG + Intronic
1124287097 15:28411219-28411241 GAGAGGAGAAGGAAGGGGAGGGG - Intergenic
1124574353 15:30895045-30895067 GAGAGGACAAGTATTGTAAGAGG + Intergenic
1124715105 15:32052408-32052430 GAGAGGAGAAGTTGGTTAAAGGG + Intronic
1125102672 15:35932952-35932974 GAGTGGAGCAGTAGGGTAAGGGG + Intergenic
1127714156 15:61632113-61632135 GAAAGGAGAAGGAGGGAAAAAGG - Intergenic
1128308388 15:66614980-66615002 GAGAGGAGAGGAAGGGTGAGAGG - Intronic
1128368593 15:67022843-67022865 CAGAGGAGAAGTGGGGGTAGAGG + Intergenic
1128400426 15:67274258-67274280 GAGAGTTGAAGAAGAGTAAGGGG - Intronic
1128792684 15:70444653-70444675 GAAAGGAGATGTGGGGTAGGGGG + Intergenic
1128940905 15:71786850-71786872 GGGAGGAGGAGTAGGGAAGGAGG + Intergenic
1128950418 15:71874366-71874388 GATAGGAGGAGGAGGGGAAGTGG + Intronic
1129164513 15:73768717-73768739 GAGAGGAGAGGAAGGGAAGGAGG - Intergenic
1129272849 15:74428589-74428611 GAAAGGAGGAGGAGGGTGAGTGG + Intronic
1129404865 15:75309641-75309663 TAGAGGTGAGGAAGGGTAAGGGG + Intergenic
1129902647 15:79163577-79163599 GAGAGGAGAAAGGGGGAAAGAGG - Intergenic
1130145439 15:81270464-81270486 GACAGGAGATGGAGGGAAAGAGG - Intronic
1130226008 15:82058872-82058894 GAGAGGAGAGGAAGGAGAAGGGG - Intergenic
1130419661 15:83731931-83731953 GAGAGGAGATGTTGGTTAAAGGG + Intronic
1130763111 15:86841306-86841328 GAGAGGAGATGGAGTATAAGGGG + Intronic
1130940267 15:88502300-88502322 GAAAGGAGAAGTTGGGGAATGGG - Intergenic
1131284759 15:91047967-91047989 AAGAGGAGGAGGAGGGTAAGGGG - Intergenic
1132096300 15:98987657-98987679 AAGAGTAGAAGTAGAGTATGTGG - Intronic
1132336014 15:101049231-101049253 GAGAGGAGAAGAAGGGAAAAGGG + Intronic
1132399620 15:101497338-101497360 GAGAGGAGAACTAGGATAGCAGG - Intronic
1132443415 15:101892033-101892055 GAGAGAAGAAGGAGAGTAAAGGG - Intergenic
1133095305 16:3441060-3441082 GAGCGCAGAAGTAGGGCAAATGG + Intronic
1133460714 16:5984095-5984117 GAGAGGAGGAGGAGGGGGAGTGG - Intergenic
1133460723 16:5984121-5984143 GAGAGGAGGAGGAGGGGGAGGGG - Intergenic
1133485527 16:6215089-6215111 GAGAGGAGAAGGAGAGGGAGAGG + Intronic
1133526131 16:6607548-6607570 GAGAGGAGGAAGAGGGAAAGAGG - Intronic
1133823853 16:9260030-9260052 GGGAGGAGAAGTGGGGTCAGGGG - Intergenic
1133913066 16:10083550-10083572 GACAGGAGTAGCAGGGGAAGAGG - Intronic
1134504592 16:14794693-14794715 GAGAGGAGAAGTGGACTATGAGG - Intronic
1134523541 16:14928894-14928916 GGGAGGGGAAGGAGGATAAGGGG - Intronic
1134549351 16:15132026-15132048 GGGAGGGGAAGGAGGATAAGGGG + Intronic
1134563328 16:15229505-15229527 GAGAGAAGAAGAAGGGTAATAGG + Intergenic
1134575979 16:15334216-15334238 GAGAGGAGAAGTGGACTATGAGG + Intergenic
1134711135 16:16327378-16327400 GGGAGGGGAAGGAGGATAAGGGG - Intergenic
1134718985 16:16370679-16370701 GGGAGGGGAAGGAGGATAAGGGG - Intergenic
1134726464 16:16422285-16422307 GAGAGGAGAAGTGGACTATGAGG - Intergenic
1134923855 16:18141133-18141155 GAGAGAAGAAGAAGGGTAATAGG + Intergenic
1134940967 16:18289574-18289596 GAGAGGAGAAGTGGACTATGAGG + Intergenic
1134948439 16:18341205-18341227 GGGAGGGGAAGGAGGATAAGGGG + Intergenic
1134955696 16:18381315-18381337 GGGAGGGGAAGGAGGATAAGGGG + Intergenic
1135066576 16:19315011-19315033 GGGAGGAGGAGGAGGGAAAGTGG + Intronic
1135066597 16:19315068-19315090 GGGAGGAGGAGGAGGGAAAGTGG + Intronic
1135518619 16:23156265-23156287 GAAAGGAGAAATAGGGGAGGAGG + Intergenic
1135654809 16:24238631-24238653 GAGAGGAAAGGTAGGGTTTGGGG + Intergenic
1135818579 16:25658649-25658671 TAGAGGAGAAGCAGGGAGAGTGG + Intergenic
1135886527 16:26314570-26314592 GAGAGGAGGAGGATGGGAAGAGG - Intergenic
1136171630 16:28493415-28493437 GAGGGGAGAAGGAGGGTATGGGG + Intronic
1136642087 16:31575425-31575447 GAGGGCGGAAGTAGGGTGAGGGG + Intergenic
1137432457 16:48429270-48429292 GAGAAAAGAAGTATGGGAAGTGG + Intronic
1137947714 16:52750893-52750915 GAGAGGAGAAGAGAGGTGAGGGG + Intergenic
1138050515 16:53772194-53772216 GAGAAGAAGAGTAGGGGAAGAGG - Intronic
1138201119 16:55089205-55089227 GAGAGGGGAAGTCAGGGAAGAGG + Intergenic
1138315426 16:56065548-56065570 GAGGCAAGAACTAGGGTAAGTGG - Intergenic
1138506247 16:57479768-57479790 GAGAGGAGGAGTGTGGGAAGAGG - Intronic
1138530149 16:57630428-57630450 GAGAGGAGAGGAAGGGCAAGGGG - Intronic
1138598631 16:58042370-58042392 GTGAGCAGAGGTAGGGTTAGAGG + Intronic
1139278536 16:65750078-65750100 GAGAAGAGAAGGAGAGAAAGAGG + Intergenic
1140132420 16:72175259-72175281 AAGAGGAGGAATAGGGTAACTGG - Intronic
1140337210 16:74118746-74118768 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1140602233 16:76491122-76491144 AAGAGGAGAAGAAGGGCAAGGGG - Intronic
1141046955 16:80723923-80723945 GAGTGGAGAAGAAGAGGAAGAGG + Intronic
1141203994 16:81919222-81919244 GGGAGGAGAGGAAGGGTAAGAGG + Intronic
1141464467 16:84196838-84196860 GAGATGAGAGGTGGGGTGAGAGG - Intronic
1141472973 16:84252097-84252119 GGGAGGAGAAGTTGGGGCAGAGG + Intergenic
1141570253 16:84929730-84929752 GAGAGCAGGAGCAGGGGAAGCGG + Intergenic
1141635683 16:85312778-85312800 GAGAGGAGGAGCAGGGCAGGAGG + Intergenic
1143200625 17:5110913-5110935 GAGAGAAGAGGGAGGGTATGTGG + Intronic
1143481713 17:7230976-7230998 GAGAGGAGAAATAAGGAAAGGGG - Intronic
1143730769 17:8881444-8881466 GGGAGGAGAGGCAGGGTGAGGGG - Intronic
1144076244 17:11722083-11722105 GAGAGGAGAAAAAGGGTGCGAGG + Intronic
1144129506 17:12232463-12232485 GAGAGGAGAAGAAGAGTCTGGGG + Intergenic
1144689362 17:17250057-17250079 GGGAGGAGAAGGAGGGAATGGGG - Intronic
1146518127 17:33505333-33505355 GAGAGGTGAAGGAGAGAAAGGGG - Intronic
1146672710 17:34752782-34752804 GAGGGAAGGAGTAGGGTGAGAGG - Intergenic
1146705122 17:34995743-34995765 GGGAGGAGGAGGAGGGTAGGTGG - Intronic
1149378870 17:56072816-56072838 GAGAGGAGAAGGTGGGGAAAGGG + Intergenic
1149806187 17:59620037-59620059 GAGAGGAGGAGAAGGGGAGGGGG - Exonic
1150211667 17:63445513-63445535 GAAAGGAGAAGTCTGGGAAGGGG + Intronic
1150521434 17:65870920-65870942 GAAAGGGGAAGTACAGTAAGTGG - Intronic
1150583650 17:66498161-66498183 CAGAAGAGAAGTATGGAAAGTGG - Intronic
1151161784 17:72172133-72172155 GAGAGGAGAAGTGAGGAGAGAGG - Intergenic
1151212188 17:72552928-72552950 GAGGGGAGAACTGGGTTAAGCGG - Intergenic
1151292005 17:73157074-73157096 GAGAGGAGAGGTAGTTGAAGGGG + Intergenic
1151654326 17:75488791-75488813 GAGGGGAGAAGGGGGGGAAGAGG - Exonic
1152013718 17:77735983-77736005 GGGAGGAGAAGGATGGGAAGAGG + Intergenic
1152018897 17:77770334-77770356 GAGAGGAGGAGAAGGGACAGAGG - Intergenic
1152211225 17:79004221-79004243 GAGAGGAGAGTTAGGGAGAGGGG + Intronic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1153605134 18:6825597-6825619 GAGGGGGGAGGTAGGGAAAGAGG - Intronic
1153853617 18:9122247-9122269 GAGGTGAGAAGTAGGGTAGAAGG + Intronic
1155103547 18:22638500-22638522 GAGAGGGGAAGGAGGGAAGGAGG + Intergenic
1155375611 18:25153793-25153815 GAGAGGAGAAGGAGGAGAAGAGG - Intronic
1155932208 18:31719698-31719720 GCGAGTAGGGGTAGGGTAAGTGG + Intergenic
1156674565 18:39512166-39512188 GAGAAGAGAAGAAGGGGAGGAGG + Intergenic
1157199488 18:45646846-45646868 GAGAGAAGAAGAAGGGTTTGGGG + Intronic
1157276101 18:46312022-46312044 GAGAGCAGAAGTTGGGTGTGGGG + Intergenic
1157279327 18:46335312-46335334 GAGAGGGGATGTGGGGAAAGGGG - Intronic
1157547155 18:48554606-48554628 GAGAGGAGAACTTGGGAAAGGGG - Intronic
1157570256 18:48707567-48707589 AAGAGGAGGAGAAGGGAAAGAGG - Intronic
1157615491 18:48985008-48985030 GAGAGGAGAAATAGGAGAGGTGG + Intergenic
1157701387 18:49763175-49763197 GAGAGGAGGAGAGGGGGAAGAGG - Intergenic
1157869992 18:51221178-51221200 CAGAGGAAAAGGAGGGGAAGTGG + Intergenic
1158334572 18:56401949-56401971 GAGAAGGGAAGGAGGGGAAGTGG + Intergenic
1158525489 18:58209314-58209336 GAGAGGAGGAGGAGGGGGAGGGG - Intronic
1158629292 18:59098369-59098391 GAGAGTAGAAGGATGGTAACTGG + Intergenic
1159280756 18:66281443-66281465 TACAGGGCAAGTAGGGTAAGGGG + Intergenic
1159850952 18:73526863-73526885 GAGAGGAGGAGGAGGGGGAGAGG - Intergenic
1159850964 18:73526914-73526936 GAGAGGAGGAGAAGAGGAAGGGG - Intergenic
1159959659 18:74545646-74545668 GAGAGGAGGAGGAGGGTCGGAGG - Intronic
1160641509 19:141129-141151 GAGAGAAGAAGGAGAGTAAAGGG + Intergenic
1161415637 19:4145174-4145196 GAGAGGAGAGGAAGGGGAGGAGG + Intergenic
1161635040 19:5382935-5382957 GAGAGGACAGGTGGGGAAAGTGG - Intergenic
1162209147 19:9077773-9077795 GAGAAGAGAGCCAGGGTAAGGGG - Intergenic
1162373734 19:10293314-10293336 AAGAGTAGGAGTAGGGTATGAGG + Intronic
1162984084 19:14258258-14258280 GGGAGGAGGAGAAGGGAAAGGGG - Intergenic
1163093214 19:15035808-15035830 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1163511721 19:17739487-17739509 GAGGGGAGACGCAGGGGAAGCGG + Intergenic
1163772031 19:19197074-19197096 GAGAGGAGTAGGAGGGTGGGAGG + Intronic
1163827823 19:19533470-19533492 GAAAGGAGGAGGAGGGTAAGAGG - Intronic
1164249584 19:23465466-23465488 GAGAGGAGGAGAAGGATGAGAGG - Intergenic
1164249776 19:23466589-23466611 GAGAGGAGAAGGAGAGTAGAAGG - Intergenic
1164249804 19:23466738-23466760 GAGAGGAGAAGGAGGAGGAGAGG - Intergenic
1164249912 19:23467416-23467438 GAGAAGAGAAGGAGAGAAAGAGG - Intergenic
1164292216 19:23879026-23879048 GAGAGAAGAAGAAGGTGAAGGGG + Intergenic
1164292257 19:23879271-23879293 GAGAGGAGAAGGAGGAGAGGAGG + Intergenic
1164292533 19:23880858-23880880 GAGAGGAGAAGTAAGAGGAGAGG + Intergenic
1164292580 19:23881158-23881180 GAAAGGAGGAGTAGGGGGAGAGG + Intergenic
1164292649 19:23881567-23881589 AAGAGGAGAAGAAGGGGAGGAGG + Intergenic
1164324496 19:24179933-24179955 AAGAGGAGAAGAAAGGTGAGAGG + Intergenic
1164324581 19:24180394-24180416 GAGAGGAGAAGGAGGAGGAGTGG + Intergenic
1164324679 19:24180968-24180990 GAGAGGAGAAAAAGAGTAGGAGG + Intergenic
1164441711 19:28284526-28284548 AAGAGGAGAAGAAGGGTGAAGGG + Intergenic
1164667552 19:30051551-30051573 AAGAGGAGAAGTAGAAAAAGAGG - Intergenic
1164718453 19:30412666-30412688 AAGAGGAGAAGAAGGAGAAGGGG - Intronic
1164921793 19:32093825-32093847 GAGAGGAGGGGCAGGGTAGGAGG + Intergenic
1165147824 19:33743126-33743148 GAGAGGGGAAGGAGGATCAGGGG - Intronic
1165645229 19:37430599-37430621 CAGAGAGGAAGTAGGGAAAGAGG + Intronic
1165648386 19:37464998-37465020 GAGAAGAGAAGAAAGGTAAGTGG - Intronic
1165862220 19:38915337-38915359 GACAGGAGAAGCAGAGGAAGAGG - Intronic
1166816118 19:45547229-45547251 GAGGGGAGAAGTTAGGTGAGGGG - Intronic
1166881946 19:45935121-45935143 GAGAGGTGGGGTAGGGAAAGGGG + Exonic
1166936832 19:46339020-46339042 AAGAGGAGAAGAAGGGAAAAAGG - Intronic
1167016717 19:46845933-46845955 GAGTGGCGAAGTAGGGCACGAGG + Intronic
1167191302 19:47991790-47991812 GAGGGGAGAAAGAGGGAAAGGGG - Intronic
1167715392 19:51139707-51139729 GAGAGCAGAAGCAAGGTGAGGGG + Intergenic
1168063189 19:53905658-53905680 TAGAGGAGATGAAGGGGAAGAGG - Intronic
1168236677 19:55068079-55068101 GAGAGGAGAAAGAGAGGAAGGGG - Intronic
1168242692 19:55095366-55095388 GAGAGGAGAAGGGGAGGAAGGGG + Intronic
1168357845 19:55713580-55713602 GAGAGGAGGAGGAGGGGAGGAGG - Intronic
1168522459 19:57063169-57063191 GAGAGGAGAAGTAGGGCCCATGG - Intergenic
925445358 2:3922630-3922652 GAGAGGAGGGGAAGGGGAAGAGG + Intergenic
926645981 2:15290034-15290056 GAGAGGAGAAGAGGGGAGAGGGG + Intronic
927659515 2:24981046-24981068 GAGAGAAGAAGGAGGGGGAGGGG + Intergenic
927962791 2:27250977-27250999 GAGTGGAGAAGGAGGATAGGAGG + Intergenic
928261636 2:29772677-29772699 GAGAGGAGATGGAGGGTAAGGGG + Intronic
928300655 2:30121347-30121369 GAAAGGAGACGAAGGGGAAGGGG - Intergenic
929974671 2:46620934-46620956 GATAGGGGAAGTAGGGGAAAGGG - Intronic
930669190 2:54130373-54130395 GAGGAGAGAAGTAGGATATGAGG + Intronic
931512845 2:63019771-63019793 GAGGGGAGGAGAAGGGAAAGGGG + Intronic
931677237 2:64709538-64709560 GAGAGCAGGAGTAGGGGCAGTGG - Intronic
932299975 2:70659818-70659840 GAGAGGACAAGAAGGATTAGTGG - Exonic
932390359 2:71384141-71384163 GAGAGCTGAAGTAGAGTCAGTGG - Intronic
933587273 2:84193103-84193125 GAGAAGAGAAGTAGGCTAAAAGG + Intergenic
934895006 2:98110104-98110126 GAGAAGAGAAAGAGGGTAGGGGG - Intronic
935098578 2:99970666-99970688 GGGAGGAGAAGGAGGGTTAGAGG - Intronic
935171472 2:100613958-100613980 GAAGGGAGAAGGAGGGAAAGAGG - Intergenic
936056757 2:109267691-109267713 GAGAGTAAAAGAAGGGAAAGGGG - Intronic
936509928 2:113137179-113137201 CAGAGGGGAAGGAGGGCAAGAGG + Intergenic
937886353 2:126902175-126902197 GAGAGGAGTGGGAGGGTGAGGGG - Intergenic
938272817 2:129990202-129990224 AAGAGGAGGAGAAGGGGAAGGGG + Intergenic
938671979 2:133595420-133595442 GAGAGGAGAAGAAGAGGAGGTGG - Intergenic
939011787 2:136855411-136855433 GAGAGAAGAAGAAGGGAAACAGG - Intronic
939097625 2:137852573-137852595 CTGAGGGGAAGCAGGGTAAGTGG + Intergenic
939954418 2:148514627-148514649 GAGAGGAGCAGTAGGAGAGGTGG - Intronic
940039668 2:149347157-149347179 GAGAGAAGAAGAAGAGAAAGAGG + Intronic
940041800 2:149369080-149369102 CAGAGGAGAAATAGGGTGAAGGG + Intronic
940143471 2:150521483-150521505 GAGAGGGGCAGCAGGGGAAGAGG - Intronic
940558446 2:155263283-155263305 GAGAGGAGAAGAATTATAAGAGG + Intergenic
941748986 2:169116061-169116083 GAGGGGAGAGGGAGGGGAAGTGG - Intergenic
941809191 2:169738871-169738893 GGGAGGAGAGGGAGGGGAAGGGG - Intronic
941841138 2:170085992-170086014 GAGAAGAGAAGTAGAGTAGAAGG + Intergenic
942320599 2:174732613-174732635 GAGAGGAGAAATTCGGTAGGGGG - Intergenic
942522534 2:176819398-176819420 GAGAGGAAATGAAGGGTGAGTGG - Intergenic
943223566 2:185140528-185140550 GAGAGGTGATGTAGGGTATGTGG - Intergenic
944450813 2:199840496-199840518 GAGATGAGAGGTGGGGTAAGGGG + Intronic
945103842 2:206289451-206289473 GAGAGGAGAGGTGGGTGAAGTGG + Intronic
945404109 2:209424179-209424201 GAGAGGGGTAGAAGGGTTAGGGG - Intronic
945904472 2:215575741-215575763 AAGAGGAGACATTGGGTAAGAGG + Intergenic
946679904 2:222202414-222202436 GAGGGGAGAAGAGGGGGAAGAGG + Intronic
947100712 2:226618338-226618360 GAGAGGAGAAAGAGGGTAATGGG - Intergenic
947153398 2:227136619-227136641 GAGAGGAGAGCTAGAGTTAGAGG - Intronic
947499241 2:230660173-230660195 GGGTGCAGAAGTAGAGTAAGTGG - Intergenic
947634578 2:231673491-231673513 GGGAGGAGAAGGAGCCTAAGAGG - Intergenic
948105628 2:235411544-235411566 AAAAGGAGAAGGAGGGGAAGGGG + Intergenic
948440475 2:237984026-237984048 AAGAGGAGGAGTAGGGGAGGGGG - Intronic
948556163 2:238813033-238813055 GAAAGGGCAAGTGGGGTAAGTGG + Intergenic
1169285923 20:4307069-4307091 GAGAGAAGAAGAAGAGGAAGAGG + Intergenic
1169464113 20:5822681-5822703 GAGAGGAGATGAAGATTAAGTGG - Intronic
1169534134 20:6518732-6518754 GAGATGAGAGGTAGAGTGAGGGG + Intergenic
1170343972 20:15362926-15362948 GAGAAGAGAAGAGGGGAAAGGGG + Intronic
1170456240 20:16536359-16536381 GTGAAGAGAAGTAGGTTAATGGG + Intronic
1170917757 20:20644676-20644698 GAAGGGAGAAGTTGGGGAAGGGG - Intronic
1170932163 20:20778985-20779007 GAGAGGAGAACAAGGGCAGGAGG - Intergenic
1171010848 20:21508731-21508753 GAGAGGGGAAGAAGGAGAAGGGG - Intergenic
1171191004 20:23159493-23159515 GAGAGGAAAAGCAGAGGAAGTGG + Intergenic
1171250787 20:23645400-23645422 GAGAAGAGAAGTTGGTGAAGGGG - Intergenic
1171562329 20:26136704-26136726 GAGGGGGGAAATAGGGTGAGAGG + Intergenic
1171769916 20:29314418-29314440 AAGGGGAGGAGGAGGGTAAGAGG + Intergenic
1172629146 20:36366692-36366714 GATGGGAGAAGTTGGGAAAGGGG - Intronic
1172761128 20:37323152-37323174 GAGAGGCGAAGGAGGTGAAGTGG - Intergenic
1173845240 20:46184079-46184101 GAGAGAGAAAGCAGGGTAAGAGG - Intronic
1174287529 20:49483470-49483492 GGGAGGAGAAGGAGGAGAAGGGG - Intergenic
1174298970 20:49568356-49568378 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1174423900 20:50418570-50418592 GAGAGGAGAAGAAAGGGAAAAGG + Intergenic
1174566641 20:51469512-51469534 GGGAGGAGGAGTCGGGTAGGGGG - Intronic
1174846776 20:53950205-53950227 GGGTGGAGAGGTAGGGTAGGGGG - Intronic
1174899935 20:54488750-54488772 GAGGGGAGGGGTAGGGAAAGAGG - Intronic
1175134799 20:56815152-56815174 GAGAGGAGGAGGAGGGGGAGGGG + Intergenic
1175658426 20:60792089-60792111 GAGAGGAGAAGGAAGGGGAGGGG - Intergenic
1176293104 21:5056499-5056521 GTGAGAGGAAGTAGGGCAAGCGG + Intergenic
1178259668 21:31087477-31087499 GAGAGGAGGAGGAGGGGAGGAGG - Intergenic
1178503698 21:33146367-33146389 GAGAGGAGAGGTAGGGATGGTGG - Intergenic
1178890218 21:36514705-36514727 GAGAGGAGAAGGGGGAGAAGGGG + Intronic
1179030036 21:37712494-37712516 GAGAGGAGGAGAAGGGGAGGAGG - Intronic
1179030082 21:37712634-37712656 GAGAGGAGGAGAAGGGGAGGAGG - Intronic
1179040096 21:37795349-37795371 GTGAGGAAAATTAGGGCAAGAGG + Intronic
1179240503 21:39586410-39586432 CAGAGGATAAGAAGGGTAGGAGG + Intronic
1179573413 21:42291740-42291762 CAGGGCAGAAGTAGGGGAAGGGG - Intronic
1179864156 21:44207151-44207173 GTGAGAGGAAGTAGGGCAAGCGG - Intergenic
1180649422 22:17366581-17366603 GAGAAGGGAAGAAGGGTGAGTGG + Intronic
1181917418 22:26292270-26292292 GAAAGGAGAAGTTGGTTTAGAGG + Intronic
1182087997 22:27574662-27574684 GAGAGAGGAAGAAGGGGAAGAGG + Intergenic
1182164699 22:28161692-28161714 GAGAGGAGAGGAGGGGAAAGAGG + Intronic
1182194097 22:28496460-28496482 GAGAGCAAAAGAAGGGTCAGTGG - Intronic
1182295952 22:29311373-29311395 GAGAGGAACAGCAGGGTATGTGG - Intronic
1182568285 22:31216082-31216104 GAGAAGTGAAGTAGGGTAAGGGG + Intronic
1182862246 22:33570225-33570247 GAGAGGAGAAGTGGGCTTAGAGG - Intronic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183332565 22:37229279-37229301 GAGAGGGCAAGGAGGGTGAGGGG + Intronic
1183615802 22:38944663-38944685 GAGAGGGGAAGGAGGGCAAAAGG - Intergenic
1183701554 22:39454022-39454044 TAGAGGAGCAGTGGGGCAAGAGG + Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1183782420 22:40007365-40007387 GAGAGGAGGAGGAGAGGAAGAGG - Intronic
1184305539 22:43598430-43598452 GATAAGAGAAGTTGGATAAGGGG + Intronic
1184319586 22:43730212-43730234 GAGAGGAAAAGGAGGGCAGGAGG + Intronic
1184526680 22:45028013-45028035 GAGAGGGGAAGAAGAGGAAGGGG + Intergenic
1185004910 22:48270104-48270126 GAGAGGAGAGAGAGGGGAAGGGG + Intergenic
949907597 3:8871726-8871748 GAGAGGAGAAGCAGGGGAGCAGG - Intronic
950128478 3:10526164-10526186 GAGAGGAGAAGGAGAGGATGGGG - Intronic
950936240 3:16842458-16842480 GTGAGCAGAAGTAGGGAGAGGGG + Intronic
951133853 3:19080049-19080071 AAGAGGAGAGGGAGGGTCAGAGG + Intergenic
953098820 3:39806353-39806375 GAGAGGAGTAGTGGAGAAAGAGG + Intergenic
953329756 3:42043225-42043247 GGGAGGAGAAGGAGGGCAAGAGG - Intronic
953664753 3:44917737-44917759 GAGAGAAGAAGGAGGGGAAATGG + Intronic
953871321 3:46629798-46629820 GAGAGGAGGAGGAGGGGAAGAGG + Intergenic
954067164 3:48116090-48116112 AAGTGGAGAGGAAGGGTAAGGGG - Intergenic
954454943 3:50592746-50592768 CGGAGGAGAAGTAGGGTTGGGGG - Intergenic
954588139 3:51754623-51754645 CAGAGGAGAAGAAAGGAAAGAGG + Intergenic
955062821 3:55507888-55507910 GAGAGAAGAAGGAGGGGAAAGGG + Intergenic
955127814 3:56131680-56131702 GATAGGAGAAGAGGGGTGAGGGG + Intronic
955406624 3:58629824-58629846 GGGAGGAGAAAAAGGGGAAGTGG + Intergenic
955509396 3:59664339-59664361 ATGAGGACAAGTAGGGAAAGGGG + Intergenic
956440908 3:69279703-69279725 GAGGGGAGGAGGAGGGGAAGAGG - Intronic
956440919 3:69279734-69279756 GAGGGGAGGAGGAGGGGAAGAGG - Intronic
956643360 3:71435153-71435175 GGAAGGAGAAGGAGGGAAAGGGG + Intronic
957296333 3:78337547-78337569 GAGAAGAGAAGTAGAGAAAAGGG + Intergenic
957883807 3:86256544-86256566 GGGAGGAGTAGTTGGGGAAGAGG + Intergenic
957901988 3:86506372-86506394 GAGAGGGGAAGGAAGGGAAGGGG + Intergenic
960193809 3:114740577-114740599 TAGAGGAGAAGTAGAGTAAATGG + Intronic
960625373 3:119677042-119677064 GGGAGGAGGAGTGGGGGAAGGGG + Intronic
961532420 3:127547670-127547692 GAAAGGAGGAGGAGGGGAAGAGG - Intergenic
962028359 3:131572593-131572615 GAGTGGAGAAGGATGGAAAGTGG + Intronic
962298703 3:134217416-134217438 GGTAGGAGAAGTAGGGTTAGAGG - Intronic
962330178 3:134471542-134471564 GAGGGGAGCAGTAGGGTAAGTGG + Intergenic
962422018 3:135237490-135237512 GAGAAGAGAAGAAGAGGAAGAGG - Intronic
962619907 3:137167961-137167983 GAGAGGAGAGGAAAGGAAAGGGG - Intergenic
962842827 3:139251388-139251410 GAGAGGAGAAAGAGGGGAGGAGG - Intronic
962863674 3:139428410-139428432 GAGAGAAGAAGAAGAGGAAGAGG - Intergenic
963093417 3:141508707-141508729 AAGTAGAGAAGTAGGATAAGAGG + Intronic
963154076 3:142077438-142077460 GAGTGGAGAAGGAAGTTAAGAGG + Intronic
963343488 3:144066699-144066721 AAGGGGAGAAGTAAGGAAAGAGG + Intergenic
963480144 3:145862287-145862309 GAGAGTAGAAGGAGGGTTACCGG - Intergenic
964080036 3:152743387-152743409 TAGAAGAGAAGCAGGGGAAGAGG - Intergenic
964088364 3:152845682-152845704 GAGAGGAGAGGAAGGGAAGGGGG - Intergenic
964374370 3:156035290-156035312 AAGAGAAGAAGATGGGTAAGGGG - Intergenic
964736995 3:159927760-159927782 GAGAGCAGAAATGGGGTCAGTGG + Intergenic
965896277 3:173580668-173580690 GAAAGGAGAAGGAGGGATAGAGG - Intronic
965903918 3:173678961-173678983 GAGAGAAAAAGTATGGTAAATGG + Intronic
966371083 3:179251484-179251506 AGGAGGAGAAGGAGGGTGAGAGG - Exonic
967553350 3:190825773-190825795 GAGAGGAAAGGAAGGGAAAGTGG - Intergenic
967567861 3:190992532-190992554 TAGAGTAGAAGTGGGGTATGGGG + Intergenic
967609681 3:191489547-191489569 AAGAGGAGAAGGAGGGAATGGGG + Intergenic
967867212 3:194200022-194200044 GTGAGGAGAGGTTGGGGAAGTGG + Intergenic
968708444 4:2095124-2095146 GAGAGTAGAAGAAGGGTGAGTGG + Intronic
969249059 4:5955300-5955322 GCGGGGAGAGGTGGGGTAAGGGG + Intronic
969616051 4:8253143-8253165 GAGAAGAGAGGCAGGGAAAGGGG - Intergenic
970342707 4:15123134-15123156 GAGAGTAGAAGGAGGGCCAGAGG - Intergenic
971221079 4:24706474-24706496 GAGAGAAGAAGAAGGAGAAGGGG - Intergenic
971420261 4:26467921-26467943 GGAAGGAGAAGGAGGGGAAGGGG + Intergenic
971591010 4:28469358-28469380 GAAAGGAGAAGTAGGAATAGAGG + Intergenic
972044201 4:34642739-34642761 GAGTGGAGAAGTATGGAGAGAGG + Intergenic
972421962 4:38895966-38895988 GAGAAGAGAATTAAGGTAGGCGG - Intronic
972853234 4:43074946-43074968 AAGTGGAGAAGAAGGGGAAGGGG - Intergenic
973826794 4:54715548-54715570 GAGAGGAGAAGAAGGGTGCCAGG + Intronic
974397640 4:61359432-61359454 GGGAGGAGAAGAATGGTAGGAGG - Intronic
975893540 4:79058433-79058455 GAGAGGAGCAGGAACGTAAGTGG + Intergenic
976474906 4:85473028-85473050 GAGAGGAGCAGTATAGTCAGAGG + Intergenic
977098310 4:92774203-92774225 GACAGGAAAAGTAGGGACAGGGG + Intronic
978330111 4:107603318-107603340 GAGGGAAGAAGCAGGGTAGGGGG - Intronic
979258205 4:118625746-118625768 GAGGGGAGAACTAGGGGAGGAGG + Intergenic
979330144 4:119414822-119414844 GAGGGGAGAACTAGGGGAGGAGG - Intergenic
979567368 4:122169880-122169902 TAGAGGTGATGGAGGGTAAGAGG + Intronic
980419103 4:132536888-132536910 GAGAGGAGAAGGAGAGGAGGAGG - Intergenic
980795699 4:137679880-137679902 GAAAGGAGAAGGATGGAAAGTGG - Intergenic
981747333 4:148064154-148064176 GGGAGGAGAATTAGGTGAAGTGG + Intronic
981852379 4:149246166-149246188 GAAAGGTGAAGAAGGATAAGGGG - Intergenic
981863580 4:149386259-149386281 GAGAGAAGAATGAGGGAAAGTGG + Intergenic
981955616 4:150469829-150469851 GAGAGGAGAAATGATGTAAGAGG - Intronic
981990057 4:150907333-150907355 GAGAGGGGAGGAAGGGGAAGGGG + Intronic
982013693 4:151131078-151131100 GAGAGGAAACATAGGGAAAGGGG - Intronic
982227889 4:153182430-153182452 GAGCTGAGAAGTGGGGTCAGTGG - Intronic
982318151 4:154052005-154052027 GAAAGGGGAAGTAGGGGAAAGGG - Intergenic
982373166 4:154656795-154656817 GAGAGGAGCAGTGGGAAAAGAGG - Intronic
982427294 4:155280109-155280131 GAGAGGAGAAGGAGGAAAAAGGG + Intergenic
983992894 4:174143529-174143551 GACAGATGAAGAAGGGTAAGTGG - Intergenic
984180540 4:176477542-176477564 GTGAGGAGATGTTGGTTAAGAGG + Intergenic
984686801 4:182678531-182678553 GAGAGGTGGAGTAGGGTGGGAGG + Intronic
985140989 4:186840557-186840579 GGGAGGAGAAGGAGGGGAAGGGG - Intergenic
986362400 5:6993118-6993140 GGGAGGAGGAGGAGGGCAAGGGG - Intergenic
986412304 5:7493145-7493167 GAAAGCAGAAGTAAAGTAAGAGG + Intronic
987192044 5:15488403-15488425 GAGAAGAGAAATAGAGCAAGAGG + Intergenic
987469740 5:18312505-18312527 GAGAGGAACGGTAGGGGAAGGGG - Intergenic
987729082 5:21744409-21744431 GAGAGGAGAGGGAAGGTGAGAGG + Intergenic
988710640 5:33770831-33770853 AAGAGGAGGAGGAGGGGAAGAGG - Intronic
989538529 5:42591721-42591743 GGGAGGGGCAGGAGGGTAAGGGG - Intronic
989659122 5:43779912-43779934 GAGAAGAGAAGTATAATAAGTGG + Intergenic
990501530 5:56401106-56401128 GAGGGGAAAAGGAGGATAAGGGG + Intergenic
990589656 5:57249775-57249797 GAGGGGGGAAGGAGGGGAAGGGG - Intronic
990975134 5:61553424-61553446 GAGAGGAGAAGTGGGTAAAAAGG - Intergenic
991252802 5:64582478-64582500 GAGAGGACAAGCAGAGTCAGAGG - Intronic
991348470 5:65694901-65694923 GAGAAGAGGAATAGGGTAGGAGG + Intronic
991398041 5:66225118-66225140 AAGAGGAAAAGCAGGGTAAGAGG + Intergenic
991547910 5:67804090-67804112 GAAAGGAGCAGGAAGGTAAGGGG - Intergenic
991968459 5:72114814-72114836 GAGAGGAACAGGAGGGCAAGAGG - Intronic
992405277 5:76451428-76451450 GAGAAAACAGGTAGGGTAAGAGG - Intronic
992575613 5:78107615-78107637 CAAAGGAAAAGTAGGGTAAATGG + Intronic
992578983 5:78151852-78151874 GAGAGGAGGGGGAGGGGAAGGGG - Intronic
992856690 5:80868936-80868958 AAGAGGAGAAGTTGGGGAAGAGG - Intronic
992980440 5:82165266-82165288 AAAAGGAGAAATAGGGCAAGGGG - Intronic
993085771 5:83361938-83361960 GAGAGGGGAAGGAGGGACAGAGG - Intergenic
993144573 5:84077786-84077808 AAGAGGAGGAGGAGGGGAAGAGG - Intronic
993641046 5:90406357-90406379 AAGAGGAGCAGTAGGGTATTTGG + Intronic
993720360 5:91315841-91315863 GAAAGGAGAAGAAGGGGAAGGGG + Intergenic
994621725 5:102172047-102172069 GAGAGATGAAGTAGGGTATCTGG + Intergenic
995123785 5:108560124-108560146 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
995740073 5:115347008-115347030 CTGAGGAGAAGTAGTGAAAGAGG + Intergenic
996043588 5:118844475-118844497 GAGAGGAAAAGAGGGGCAAGAGG + Intronic
997225741 5:132208373-132208395 GAGAGGAGGAGAAGGGGGAGGGG + Intronic
997492137 5:134286162-134286184 GAGAGGTGATTTAGGGTAACTGG - Intergenic
998051633 5:139040958-139040980 GAGAAGAGAACAAGGTTAAGTGG + Intronic
998252312 5:140561485-140561507 GAGAGGGGAATTAGGGTAAAAGG + Intronic
998397247 5:141826620-141826642 GAGAGAAAAAGCAGGGTAGGGGG - Intergenic
998469949 5:142375794-142375816 CAGAGGAGAAGCAGGGCAAAGGG - Intergenic
998991572 5:147823196-147823218 GAAAGGAGAAGGAGGGGCAGGGG - Intergenic
999148713 5:149412809-149412831 GACAGGAGGAGTAGAGTATGTGG - Intergenic
999513083 5:152273192-152273214 GAAAGGGGAAGTAGGGTACCTGG + Intergenic
999809098 5:155110983-155111005 CCCAGGAGAAGTAGGGTCAGCGG - Intergenic
1000627985 5:163561523-163561545 AAGAGGAGCAGAAGGGTATGTGG + Intergenic
1000872609 5:166595739-166595761 GTAAGGAGAATTATGGTAAGTGG - Intergenic
1000990641 5:167908352-167908374 GAGAGGAGAAGAGGGGGGAGGGG - Intronic
1001435315 5:171695255-171695277 CAGGGGAGAAGTAGGGTGACTGG - Intergenic
1002368563 5:178731173-178731195 GTGAGGAGAAACAGGGTATGTGG + Intergenic
1002482213 5:179510109-179510131 GAGGGGAGAAGAAGAGGAAGAGG - Intergenic
1002735347 5:181383359-181383381 GAGAGAAGAAGGAGAGTAAAGGG - Intergenic
1002749173 6:90768-90790 GAGAGAAGAAGGAGAGTAAAGGG + Intergenic
1002844330 6:933627-933649 GAGTGGAGAAGTTGTGTCAGGGG + Intergenic
1002898478 6:1392545-1392567 GAGAGGAGAAGAAGGGGAGCAGG - Intronic
1003266157 6:4566426-4566448 GAGAGGAGAAGTTAGGGAAGAGG + Intergenic
1003645998 6:7913213-7913235 GAGAGGAGGAGCAGTGTCAGTGG - Intronic
1004002070 6:11604864-11604886 GAGAGGAGAAGGGGGGTAGGGGG + Intergenic
1004028613 6:11843813-11843835 GAGAGGGGAATCAGGGTGAGTGG + Intergenic
1004241185 6:13924391-13924413 GAGAGGAGGAGGAGGGGGAGAGG + Intergenic
1004383096 6:15149156-15149178 GAGGGCAGAAGTGGGGGAAGTGG + Intergenic
1005569221 6:27128434-27128456 GAGGGGAGGAGTGGGGGAAGGGG + Intronic
1005953792 6:30649616-30649638 TAGAGGAGAAGATGGGGAAGTGG - Exonic
1006663968 6:35675902-35675924 GAGAGGAGTCCTAGGGTTAGAGG - Intronic
1007095616 6:39210974-39210996 GAAAGGTGGAGTAGGGGAAGGGG - Intronic
1007124925 6:39417995-39418017 AAGGGGAGAAGGAGGGAAAGAGG - Intronic
1007369584 6:41417576-41417598 GAGAGGGGAAGTGGGGTTAGAGG - Intergenic
1007461537 6:42022746-42022768 CAGTGGGGAAGTAGCGTAAGGGG + Intronic
1007759796 6:44127290-44127312 AAGAGGAGAAGGAGGGAATGAGG + Intronic
1008618566 6:53249606-53249628 GTGAGGAGAACTGGGGTAACAGG - Intergenic
1008781826 6:55116497-55116519 AAGAGGAGAAGAAAGGAAAGAGG + Intronic
1009263593 6:61526910-61526932 CAGCAGAGAAGTAGGGCAAGGGG - Intergenic
1009462177 6:63926556-63926578 GAAGGGAGAAAGAGGGTAAGTGG + Intronic
1009593696 6:65708660-65708682 GAGAGGAGGAGGAGGGGAAAAGG - Intergenic
1009761580 6:68013509-68013531 GAGAGGAGAAATAGCGAAAAAGG + Intergenic
1010097435 6:72063237-72063259 CAGAGCAGAAATAAGGTAAGGGG - Intronic
1010355338 6:74925929-74925951 GAAAGGAGAAGGAGAGGAAGCGG - Intergenic
1011517127 6:88166563-88166585 AAGAGGAGAAGTAGGTGACGCGG - Intergenic
1011531190 6:88322696-88322718 GTGAGGAGAAAGAGGGAAAGGGG + Intergenic
1011840906 6:91497798-91497820 AAGAGGAGGAGGAGGGAAAGAGG - Intergenic
1011970061 6:93211439-93211461 GAGTGGGGAAGTGGGGAAAGGGG + Intergenic
1013300678 6:108802473-108802495 GAGAGGACAATTAGGGTGATGGG - Intergenic
1013752424 6:113422780-113422802 GAGAGGAGAGGAAGGGAGAGAGG - Intergenic
1013824558 6:114195738-114195760 GAGAGGAGAAAGAGGGAAAGTGG + Intronic
1014166091 6:118226711-118226733 GAGAGGAGTGGTAGGGGATGAGG + Intronic
1014494386 6:122102331-122102353 AAGAGGAGAAGTGGGGGAGGAGG + Intergenic
1014544649 6:122719598-122719620 GACAGGAGAAGTAAGTTCAGGGG + Intronic
1014786713 6:125627738-125627760 TAGGGGAGATGGAGGGTAAGAGG + Intergenic
1014854334 6:126381103-126381125 TGGAGGAGAATTGGGGTAAGGGG - Intergenic
1014905509 6:127022104-127022126 GAGAGGAGAAGGAGGAGGAGAGG + Intergenic
1015037525 6:128674592-128674614 TGGTGGAGAAGTAGAGTAAGGGG + Intergenic
1015141084 6:129932442-129932464 GAGAGGAAAAGGAAGGAAAGGGG + Intergenic
1015196307 6:130527783-130527805 AACAGGAGAATCAGGGTAAGAGG + Intergenic
1015573060 6:134641879-134641901 GAGAGGAGAAGATAGGGAAGGGG + Intergenic
1017339636 6:153305446-153305468 AGGAGGAGGAGTAGGGGAAGGGG - Intergenic
1017652621 6:156597296-156597318 TAGAGGAGAAATAGGGGAATGGG - Intergenic
1018394026 6:163363405-163363427 GAGAGCAGAAGTGGTGTTAGAGG - Intergenic
1018424481 6:163667982-163668004 GGGATGAGAAGCAGGGTGAGGGG + Intergenic
1019029717 6:168999922-168999944 GGGAGGATAAGCAGAGTAAGTGG + Intergenic
1019223479 6:170493196-170493218 GAGAGGAGAAGGAGGTGAGGAGG + Intergenic
1019223508 6:170493269-170493291 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223526 6:170493315-170493337 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223537 6:170493342-170493364 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019223548 6:170493369-170493391 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1019239614 6:170655670-170655692 GAGAGAAGAAGGAGAGTAAAGGG - Intergenic
1019883481 7:3883785-3883807 GAGACTAGAACTAGGGCAAGAGG - Intronic
1019901941 7:4027856-4027878 GAGAGGAGAAGGGGGAGAAGGGG + Intronic
1019996009 7:4724976-4724998 GAGAGGAGAAGTGGGTTTGGGGG + Intronic
1020530404 7:9326250-9326272 GAGGGGAGAAGTAGGAAAGGAGG - Intergenic
1020569602 7:9842687-9842709 GAGAGGAGAAATAGTTTAATTGG - Intergenic
1021063366 7:16141964-16141986 GAGAGAGGAAATAGGGGAAGGGG + Intronic
1021138971 7:16999792-16999814 GAGAGGAGAGAAAGGGAAAGGGG - Intergenic
1021262435 7:18474837-18474859 GAGAGGAGAAGGGTGGAAAGGGG + Intronic
1021663831 7:22952245-22952267 GAAAGAGGAAGTAGGGTAATAGG + Intronic
1022470886 7:30681442-30681464 GAGGGGAGGAGGAGGGTAGGAGG - Intronic
1022536529 7:31102006-31102028 GAGAGGAGAAGGAAGGAAGGAGG - Intronic
1022569951 7:31442536-31442558 GAGAGGAGACGGAGGGACAGGGG + Intergenic
1023088712 7:36598033-36598055 GAGAGGAGGGGTAGGGTAGGTGG + Intronic
1023214456 7:37847263-37847285 AGGAGGAGAAGGAGGGGAAGAGG + Intronic
1023214478 7:37847389-37847411 AGGAGGAGAAGGAGGGGAAGAGG + Intronic
1023214509 7:37847584-37847606 AGGAGGAGAAGGAGGGGAAGAGG + Intronic
1023214532 7:37847695-37847717 AGGAGGAGAAGGAGGGGAAGGGG + Intronic
1023400190 7:39787040-39787062 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1024010028 7:45259383-45259405 GAGTGGAGATGTAAGGTAACTGG + Intergenic
1024073118 7:45802791-45802813 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1024168872 7:46763992-46764014 GAGAGGAGAAAGAAGGGAAGAGG - Intergenic
1024196432 7:47063906-47063928 GAGAGGAGGAGTAGAGGAAGAGG - Intergenic
1024196460 7:47064014-47064036 GAGAGGAGGAGTAGAGGAGGAGG - Intergenic
1024196482 7:47064081-47064103 GAGAGGAGAAGTAGAGGAGGAGG - Intergenic
1024196554 7:47064876-47064898 GAGAGGAGGAGTAGAGGAGGAGG - Intergenic
1024196564 7:47064911-47064933 GAGAAGAGAAGTAGAGGAGGAGG - Intergenic
1024650213 7:51397397-51397419 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
1024925575 7:54610675-54610697 GAGAAGGGAAGTAGGGAAAGTGG - Intergenic
1025054360 7:55753046-55753068 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
1025132410 7:56383199-56383221 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
1025183470 7:56837653-56837675 GAGGAGAGAAGTAGGGGAGGAGG - Intergenic
1025688455 7:63739314-63739336 GAGGAGAGAAGTAGGGGAGGAGG + Intergenic
1025945060 7:66099106-66099128 GAGAGGAGGAGGAGGGGAGGAGG + Intronic
1025945107 7:66099267-66099289 GAGAGGAGGAGGAGGGGAGGAGG + Intronic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1025945167 7:66099436-66099458 GAGAGGAGGAGGAGGGGAGGAGG + Intronic
1025978081 7:66385467-66385489 GAGGAGAGAAGTAGGGGAGGAGG - Intronic
1026104005 7:67406833-67406855 GATAGGAGAAGTAGGCAAATTGG + Intergenic
1026678346 7:72446921-72446943 GAGAGGAGGAAGAGGGGAAGAGG + Intronic
1026800636 7:73397838-73397860 GGGAGGAGGAGTAGGGGAAAGGG + Intergenic
1026837594 7:73648736-73648758 GAGAGGAGAGCCAGGGTCAGAGG - Intergenic
1026837637 7:73649012-73649034 GAGAGGAGAGAGAGGGAAAGGGG - Intergenic
1027222696 7:76224006-76224028 GAGAGGGGAAGTGGGGGCAGGGG - Intronic
1027222706 7:76224028-76224050 GAGAGGGGAAGTGGGGGCAGGGG - Intronic
1027549105 7:79568419-79568441 GAGGGGAGAAGAAGGAAAAGAGG + Intergenic
1027555246 7:79656083-79656105 AAGAGGAGAAGTAAGGAAAATGG + Intergenic
1027761532 7:82285155-82285177 GAGAAGAGGAGGAGGGCAAGGGG - Intronic
1028273389 7:88820770-88820792 AAGAGAATAAGTTGGGTAAGGGG + Intronic
1028290227 7:89056474-89056496 GAAAGGAGACGTAAGGTCAGGGG + Intronic
1028427596 7:90707441-90707463 GAGAGGTGAAGGAAGGGAAGTGG - Intronic
1028428755 7:90722108-90722130 GAAGGGAGAAGAGGGGTAAGAGG - Intronic
1029067978 7:97871808-97871830 GAGGGGAGGAGGAGGGTGAGCGG + Exonic
1029229093 7:99051552-99051574 GAGAGAAGAACTGGGATAAGAGG - Intronic
1029504571 7:100955033-100955055 GGTGGGAGAAGTAGGGTAGGTGG - Exonic
1029788317 7:102816096-102816118 GAGAGCAGAGCTAGGGTAAGGGG - Intronic
1030060504 7:105617540-105617562 CAGGGGAGAAATAGGGTGAGGGG + Intronic
1032050505 7:128646485-128646507 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1032075544 7:128834069-128834091 GAGGGGAGAAGATGTGTAAGGGG + Intronic
1032309794 7:130774468-130774490 AAGAGGAGGAGGAGGGGAAGGGG - Intergenic
1032361277 7:131257711-131257733 GAGAGGAGAAGGGAGGGAAGGGG + Intronic
1032870226 7:135977205-135977227 GAGAGGAGAAGAAGAGAAGGAGG + Exonic
1033142304 7:138838395-138838417 GAGAGCTGAAGGAGGTTAAGCGG + Intronic
1034429241 7:151032882-151032904 GGGAGGGGAGGTAGGGTAATGGG + Intronic
1036182659 8:6598434-6598456 GAGGGGAGAAGAAGGGGATGGGG + Intronic
1036519640 8:9479239-9479261 GTGAGGAGAAGGAGGGTCTGAGG - Intergenic
1036536024 8:9653511-9653533 CAGAGAAGAAGAAGGGGAAGTGG + Intronic
1036676782 8:10840332-10840354 GAAAGCAGAGGTAGGGTACGAGG - Intergenic
1037308063 8:17526617-17526639 GAGAGAAGAAGAAAGGAAAGAGG + Intronic
1037344760 8:17886809-17886831 GAGAAGAGAAGTAGGGGAATTGG + Intronic
1037467265 8:19172650-19172672 GAGAGGAGAGGGAGGGGAGGGGG + Intergenic
1037753260 8:21696159-21696181 GAGGGGAGAAAGAGGGAAAGGGG - Intronic
1037903571 8:22702519-22702541 GAGAGGAGAGGAAGGGTGGGGGG + Intergenic
1037922769 8:22819197-22819219 GAGGGGAGAATCAGGGAAAGGGG + Intronic
1038319490 8:26514124-26514146 GAGGGGAGAAGCGGGGTCAGGGG + Intergenic
1038450000 8:27633843-27633865 GAGAGGAGAAGGCGGGAAGGAGG + Intergenic
1039364592 8:36916480-36916502 GAGAAGAAAAGGAGGGAAAGAGG + Intronic
1039391090 8:37181209-37181231 GAGAGGAGGAGGAAGGCAAGGGG + Intergenic
1039428573 8:37506768-37506790 AAGAGGAGAAGAAGGGAGAGAGG + Intergenic
1039494618 8:37971596-37971618 GAGAGGAGAGACAGGGTAAAGGG - Intergenic
1039687270 8:39817321-39817343 GAGAGGATAGGAAGGGTCAGGGG + Intronic
1039908776 8:41807889-41807911 GAGAGGAGAAAGAGAGGAAGGGG + Intronic
1040917213 8:52574557-52574579 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1041528459 8:58835796-58835818 GATAAGAGAAGTAAGGTGAGTGG + Intronic
1042101994 8:65283892-65283914 GAGAGGGGAAGGAGGGGAGGTGG + Intergenic
1042591903 8:70404142-70404164 GAGAGGTGAAGAAGAGTAAGGGG + Intergenic
1042905287 8:73766231-73766253 GAGAGGAGAAGTAAGAGAAAAGG + Intronic
1043765715 8:84129726-84129748 GAGAGGAGAGGCAAGGTGAGTGG - Intergenic
1043934970 8:86132447-86132469 AGGAGGAGAAGTAGATTAAGAGG - Intronic
1044055949 8:87569859-87569881 GATAGGAAAAGTGGGGTCAGAGG + Intronic
1045172590 8:99687249-99687271 GAGAGGAGAGGGAGAGTAAAGGG - Intronic
1045272401 8:100673054-100673076 TAGAAGAATAGTAGGGTAAGCGG - Intergenic
1045447863 8:102286068-102286090 GGGAGGGGAAGAAGGGTGAGAGG + Intronic
1046320209 8:112564378-112564400 GAGAGGAGAAGAGAGGGAAGGGG - Intronic
1046962380 8:120124984-120125006 GAGAGGAGGAGGAGAGAAAGTGG + Intronic
1046983229 8:120359905-120359927 AAGAGGAGAAGTAGGAAGAGTGG - Intronic
1047316416 8:123738317-123738339 AAGAGGAGAAGTGGGTTAAAGGG - Intergenic
1047474488 8:125213575-125213597 AAGAGGAGAAGAAAGGAAAGAGG - Intronic
1047494726 8:125401561-125401583 GAGGGGAGCAGGAGGGAAAGGGG - Intergenic
1047627986 8:126676747-126676769 GAGAGAAGATTTAGGGTATGTGG + Intergenic
1047655903 8:126976728-126976750 GCTAGGAGCAGTAGGGAAAGAGG - Intergenic
1047679945 8:127244362-127244384 GAGAGGAGAAGGAAGGGGAGGGG + Intergenic
1047798967 8:128289067-128289089 GAGAGGAGAGGGATGGTAAAAGG - Intergenic
1047957434 8:129986232-129986254 GAGAGGGGAAGCAGGTGAAGTGG + Intronic
1048546843 8:135395551-135395573 GATTGTAGAAGGAGGGTAAGTGG - Intergenic
1050345046 9:4677870-4677892 CTGAGGAGAAGTAGTGAAAGAGG + Intergenic
1050614797 9:7390736-7390758 GACAGGAGAAGAAGGGTATGAGG + Intergenic
1050857895 9:10384959-10384981 GAGAGGAGAAGCCAGGGAAGTGG - Intronic
1050894823 9:10873160-10873182 GAGAGGTGATTTAGGGTATGTGG - Intergenic
1051364977 9:16315470-16315492 GAGAGGAAAAGGAGAGGAAGGGG + Intergenic
1051586624 9:18733669-18733691 GAGAAGAGAAGTGGGGTGGGGGG - Intronic
1051632994 9:19157309-19157331 GAGAGAAGAAGAAGAGGAAGAGG - Intergenic
1053233806 9:36434298-36434320 GAGAGGAGCAGGAGGGGGAGGGG + Intronic
1054735539 9:68746451-68746473 GAGAGGAGAGAAAGGGTGAGGGG - Intronic
1055380090 9:75697250-75697272 GAGAGCAGAAGTAGGCTGAAGGG + Intergenic
1057036937 9:91817856-91817878 GGGAGGAGAGGGAGGGGAAGGGG + Intronic
1057181582 9:93033495-93033517 GAGAGGAGGAGAAGGGGAGGGGG - Intronic
1057487879 9:95500210-95500232 GAGAGGACAGGTTGGGTAATGGG - Intronic
1059118292 9:111618243-111618265 GAGAGGAGAGGGAGGGGGAGGGG + Intergenic
1059206196 9:112468569-112468591 GAGAGGAGAAAAAGGGAAAGGGG - Intronic
1059526088 9:114992288-114992310 GAGAGGAGAAGAGGAGGAAGGGG - Intergenic
1059735299 9:117094207-117094229 GAGAGGAGAGGAAAGGAAAGAGG + Intronic
1059770432 9:117418648-117418670 GAAAGGAGAAGGAGTGTGAGGGG - Intergenic
1060222832 9:121773555-121773577 GAGAGGAGGAGCATGGTATGGGG - Intronic
1060864310 9:126982879-126982901 AAGAAGAGAAGAAGGGGAAGGGG - Intronic
1061286475 9:129626250-129626272 GAGAGAAGAAGATGGGGAAGAGG - Exonic
1061900226 9:133668815-133668837 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061900378 9:133669252-133669274 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1062153702 9:135034239-135034261 GAGAGGAGAGGCAGGGGATGGGG - Intergenic
1062153736 9:135034346-135034368 GAGAGGAGAGGCAGGGGACGGGG - Intergenic
1203600270 Un_KI270748v1:6733-6755 GAGAGAAGAAGGAGAGTAAAGGG - Intergenic
1185459857 X:328922-328944 GAGAGGAGGAGGAGGGGGAGGGG - Intergenic
1185688244 X:1948195-1948217 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1185688533 X:2133734-2133756 GAGAGGAGGAGGAGGGGAGGAGG + Intergenic
1185975884 X:4719582-4719604 GAGAGCAGAAGAAAGGTAAAGGG - Intergenic
1186149160 X:6655864-6655886 GAGAGGGGAAGTTGGATAAAGGG - Intergenic
1186718583 X:12279007-12279029 GACAGGAGAAGGAAGGTAATAGG - Intronic
1186816861 X:13246578-13246600 GAGAGGAGATGGAAGGGAAGGGG + Intergenic
1186829271 X:13374601-13374623 GAGAGAAGAAATAGCCTAAGAGG - Intergenic
1187298209 X:18023185-18023207 GAGAAGAGCAGTTGGTTAAGTGG - Intergenic
1188059683 X:25585754-25585776 AAGATGAGAAGTGGGTTAAGGGG - Intergenic
1188320590 X:28732115-28732137 TAGAGGGGAAGTAGGTCAAGAGG + Intronic
1188775137 X:34207648-34207670 GAGAAGAGAATTAGGTGAAGCGG + Intergenic
1188980212 X:36720654-36720676 GAGAGCTGAAGTGGGGGAAGGGG + Intergenic
1189129683 X:38485358-38485380 GAGTGGAGAGGCAGGGTTAGAGG + Intronic
1189909828 X:45799381-45799403 AAAAGGAGAAGCAGGGAAAGAGG + Intergenic
1190301081 X:49058006-49058028 GGAAGGAGAAGTAGGGAAGGGGG - Intronic
1190515896 X:51223289-51223311 GAGAGGAGAAGGAGGAAAGGAGG - Intergenic
1190973161 X:55372288-55372310 GAGAAGAGAAGTTGGTTAATGGG - Intergenic
1191641128 X:63430598-63430620 GGGAGGAGAGGGAGGCTAAGAGG + Intergenic
1192040714 X:67618459-67618481 GAGAGGAGAAGGAAGAAAAGAGG + Intronic
1192131014 X:68550038-68550060 GAGAGGAGAGGTAGGGAGTGGGG + Intergenic
1192166909 X:68832185-68832207 GAGAGGAGAACTCGGGCAGGAGG - Intronic
1192834150 X:74781423-74781445 GAGAGGTGAAGGAGGAGAAGAGG + Intronic
1193151572 X:78129902-78129924 GTGAGGAGAACAAGGCTAAGAGG + Exonic
1193317247 X:80077805-80077827 GAGAGGAAAAGTGGGATCAGGGG + Intergenic
1194011642 X:88569408-88569430 AGGAGGATATGTAGGGTAAGAGG - Intergenic
1194603304 X:95950155-95950177 AAAAAGAAAAGTAGGGTAAGTGG - Intergenic
1194831287 X:98625281-98625303 GAAGGGAGAAGGAGGGAAAGAGG - Intergenic
1194875893 X:99187481-99187503 GGGAGGAAAAGAAGAGTAAGTGG - Intergenic
1195103160 X:101575399-101575421 GAGGGGAGAAGTAGGGAGAGGGG - Intergenic
1196500680 X:116377726-116377748 GAAAGAAGAAATAGGGCAAGTGG - Intergenic
1196657327 X:118232186-118232208 GAGAGGAGGAGGAGGGGAGGGGG + Intergenic
1196749309 X:119100489-119100511 GGAAGGAGAAGTAGGGTTGGAGG - Intronic
1196923364 X:120607436-120607458 ATGAGGAGAAGTTGGTTAAGGGG - Intronic
1197215188 X:123860326-123860348 GAGAGGGGAAGGAGGGAAAGCGG - Intronic
1197627308 X:128816568-128816590 GAGAGAAGCAATAGAGTAAGTGG + Intergenic
1198215326 X:134549771-134549793 GAGAGGAGCTGTAGGGAAGGGGG + Intergenic
1198265354 X:135003984-135004006 GAGGGGAGGAGTACGGTAGGAGG + Intergenic
1198367932 X:135961442-135961464 GAGAGGAGTATTAGGGTAGGAGG + Intergenic
1199599768 X:149535021-149535043 GGGAGGAGGAGGAGAGTAAGAGG - Intergenic
1199599774 X:149535045-149535067 GAGAGGAGAAGGAGAGCAGGAGG - Intergenic
1199601695 X:149544965-149544987 GAGAGCAGTGGTAGGGGAAGGGG + Intronic
1199650865 X:149945202-149945224 GAGAGGAGAAGGAGAGCAGGAGG + Intergenic
1199650871 X:149945226-149945248 GGGAGGAGGAGGAGAGTAAGAGG + Intergenic
1200305742 X:155024544-155024566 AAAAAGAGAAGTGGGGTAAGGGG + Intronic
1200733462 Y:6768319-6768341 GAGAGGAGAATTAGGGAAGATGG + Intergenic
1201300235 Y:12498732-12498754 GAGGGGAGGAGAAGGGGAAGAGG - Intergenic
1201718704 Y:17074303-17074325 GAGAGAAGAGGCAGGGTAGGGGG + Intergenic