ID: 1120129532

View in Genome Browser
Species Human (GRCh38)
Location 14:80788722-80788744
Sequence CGAGAGGAGAAGTAGGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129532_1120129541 11 Left 1120129532 14:80788722-80788744 CCCTTACCCTACTTCTCCTCTCG 0: 1
1: 0
2: 0
3: 23
4: 285
Right 1120129541 14:80788756-80788778 AATTTAGGCTATTTTACTTATGG 0: 1
1: 0
2: 3
3: 17
4: 264
1120129532_1120129538 -4 Left 1120129532 14:80788722-80788744 CCCTTACCCTACTTCTCCTCTCG 0: 1
1: 0
2: 0
3: 23
4: 285
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129532 Original CRISPR CGAGAGGAGAAGTAGGGTAA GGG (reversed) Intronic
900038499 1:435583-435605 AGAGAGAAGAAGGAGAGTAAAGG + Intergenic
900059934 1:670562-670584 AGAGAGAAGAAGGAGAGTAAAGG + Intergenic
900743525 1:4344716-4344738 CAAAAGGAGAAGAAGGGAAAAGG - Intergenic
902217994 1:14946681-14946703 TAAGAGGAGAAGTAGGTGAACGG - Intronic
903673223 1:25048497-25048519 AGAGAGGAGAAGAAGGTGAAGGG - Intergenic
905362648 1:37431092-37431114 GGATAGGAGAAGGAGGGGAAGGG + Intergenic
905882332 1:41472450-41472472 GGAGCGGGGTAGTAGGGTAAAGG + Intergenic
905944224 1:41888447-41888469 AGAGAGGAGAAGGAGGAGAAAGG + Intronic
907387500 1:54135715-54135737 TGAGAAGAGAAGGAGGGTAGGGG - Intronic
909130421 1:71728888-71728910 GGAGAGGAGGAGAAGGATAAGGG + Intronic
909435574 1:75637462-75637484 AGAGAGAAGAAGTAGCGTAGAGG + Intergenic
910722704 1:90304158-90304180 CTAGAGTTGAAGAAGGGTAAAGG + Intergenic
913004104 1:114611330-114611352 CGAGGAGTGAAGTAGGGTATGGG - Intronic
913376418 1:118157515-118157537 TGAGTGGGGAAGTAGGGAAATGG - Intronic
916332098 1:163628388-163628410 TGGGAGGAGAAGGAGGGGAAGGG - Intergenic
916726403 1:167527486-167527508 CGAGAGGGGAATGAGGGGAATGG + Intergenic
918307792 1:183263090-183263112 CAGTAGGAGAAGCAGGGTAAAGG - Intronic
920096841 1:203492008-203492030 CAAGAGGAGAAGTTGGGAGAGGG + Intergenic
921572515 1:216796257-216796279 CCAGTGGGGAAGTGGGGTAAGGG - Intronic
921760009 1:218902252-218902274 CAAGAAGAGAAGTAAGGAAAAGG - Intergenic
921848508 1:219908772-219908794 CGAGTGGAGAAAGAGGGGAAAGG - Intronic
924002364 1:239568176-239568198 TGAGTGGAGAAGGAGGGCAAAGG + Intronic
1063529766 10:6819702-6819724 GGAGAGGAGAAGGAGGGCAGGGG + Intergenic
1063809370 10:9686458-9686480 AGAGAGTAGAAGAGGGGTAAGGG - Intergenic
1065920754 10:30390678-30390700 CTAGAGGCGAGGAAGGGTAAGGG - Intergenic
1066211514 10:33243909-33243931 AGAGTGGAGAAGGAGGGTAGAGG + Intronic
1067784105 10:49229925-49229947 AGAGAGGAGAAGCCAGGTAAGGG - Intergenic
1068568965 10:58607488-58607510 AGAGAGGAGAAGGAGGATAAAGG - Intronic
1068617300 10:59133214-59133236 ACATAGGAGAAGTTGGGTAAGGG + Intergenic
1069710956 10:70488482-70488504 AGAGAGGGGAAGGAGGGGAAAGG - Intronic
1071073725 10:81727006-81727028 ATAGATGAGAAGTAGGGTAGGGG - Intergenic
1071676407 10:87659790-87659812 CGGGAGGAGGAGTAGGAGAAGGG + Exonic
1071803007 10:89085692-89085714 CTAGAGGAGATGCAGAGTAAAGG + Intergenic
1071877760 10:89861314-89861336 GAAGAGGAGGAGTAGGGAAAAGG - Intergenic
1074617319 10:115082221-115082243 CTAGACAAGAAGTAGTGTAAAGG + Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075419205 10:122288399-122288421 CGAGGGGAGATGGAGGGGAAAGG + Intronic
1075821877 10:125321421-125321443 CAAGAGTAGAAGTAGGGAGATGG - Intergenic
1076964703 11:71497-71519 AGAGAGAAGAAGGAGAGTAAAGG + Intergenic
1078823571 11:14906117-14906139 CGAGAGGAGAGGGAGGATTAGGG - Intronic
1083900787 11:65642309-65642331 CGGGAGGAGAAGGAGGGCAGCGG + Exonic
1084564502 11:69921442-69921464 CAAGAGAAGGAGGAGGGTAAAGG + Intergenic
1087137102 11:94732072-94732094 GGAGAGGTGAGGTAGGGAAATGG - Intronic
1090280038 11:125447975-125447997 GGAGGGGAGAAGTTGGGTAGAGG + Intronic
1090484772 11:127103082-127103104 AGGGAAGAGAAGTAGGTTAAAGG + Intergenic
1091332955 11:134744772-134744794 CGGGAGGAGAAGGAGGGAATGGG + Intergenic
1091941446 12:4487260-4487282 CGAGAGCAGAAATGGGGGAAGGG + Intergenic
1094083740 12:26566051-26566073 GGAGAGGAGAAGGAGAGGAAAGG + Intronic
1094459454 12:30678742-30678764 ACAGAGGAGAAGTAGGCTGAGGG + Intronic
1095375024 12:41516435-41516457 GGAGAGGAGAAGAAGGCTGATGG + Intronic
1095509252 12:42932002-42932024 AGAGAGGAGGAGTAGGAGAAAGG + Intergenic
1096229728 12:49890156-49890178 TGAAAGGAGAAGCAGGGTAAAGG + Intronic
1096886018 12:54720008-54720030 CGAGAGGTGATGAAGGGGAAGGG + Intergenic
1098145151 12:67490095-67490117 AGTGAGGAGAAGTAGGATCAGGG - Intergenic
1099724986 12:86413884-86413906 GGAGAGCAGAAGTAGGGATAGGG + Intronic
1100118145 12:91334802-91334824 AAAGTGGAGAAGAAGGGTAAAGG + Intergenic
1100954003 12:99885740-99885762 GGAGAGTAGAAGAGGGGTAAGGG - Intronic
1106447370 13:29849128-29849150 CGAGAGAATAGGTAGGGAAACGG - Intronic
1106947051 13:34840238-34840260 GGAGAGGAGAAGGAAGGGAAAGG + Intergenic
1106947071 13:34840336-34840358 GGAGAGGAGAAGGAAGGGAAAGG + Intergenic
1107974319 13:45674948-45674970 AGAGAGGAGGAGTGGGGGAAGGG + Intergenic
1110111368 13:71750136-71750158 GGGGAGGAGAAGCAGGGGAAAGG - Intronic
1110149946 13:72239124-72239146 CCTGAGGAGGAGTAGGGTAAAGG - Intergenic
1111252399 13:85619859-85619881 CTATAGGGGAAGTTGGGTAAAGG - Intergenic
1113508911 13:110836175-110836197 GGAGAGAAGAAGGAAGGTAAAGG + Intergenic
1114641700 14:24227491-24227513 CGAGACCAGAATGAGGGTAATGG + Intronic
1114931821 14:27479986-27480008 CGAGAAGCTAAGTAGGGTACTGG - Intergenic
1115699070 14:35931283-35931305 CTAAAGGTGAAGCAGGGTAATGG + Intronic
1117253297 14:53955348-53955370 CGAGAGGATAGGAAGGGGAAGGG + Intronic
1118383041 14:65233369-65233391 GGAGAGGTAGAGTAGGGTAATGG - Intergenic
1120129532 14:80788722-80788744 CGAGAGGAGAAGTAGGGTAAGGG - Intronic
1121414133 14:93767398-93767420 AGAGAGGAGGAGCAGGGAAAGGG + Intronic
1121576371 14:94991607-94991629 CAAGAGGAGAAGCAGAGTATAGG - Intergenic
1123480355 15:20625388-20625410 CTGGAGGAGAAGCAGGGAAAGGG - Intergenic
1123637653 15:22374977-22374999 CTGGAGGAGAAGCAGGGAAAGGG + Intergenic
1124715104 15:32052407-32052429 GGAGAGGAGAAGTTGGTTAAAGG + Intronic
1125102671 15:35932951-35932973 GGAGTGGAGCAGTAGGGTAAGGG + Intergenic
1125896013 15:43302247-43302269 CGACAGGAGAAGGAGGGAGATGG - Exonic
1126550910 15:49928338-49928360 CAAGAAGAGAAGTGGGGGAAAGG + Intronic
1126987271 15:54326636-54326658 GGAGGGGAGAAGTGGGGAAAGGG + Intronic
1129228377 15:74182977-74182999 CGGGAGGAGAAGGATGGTAAAGG - Intronic
1129404864 15:75309640-75309662 CTAGAGGTGAGGAAGGGTAAGGG + Intergenic
1129836572 15:78711545-78711567 CTAGAGGTGAGGAAGGGTAAGGG + Intronic
1130419660 15:83731930-83731952 GGAGAGGAGATGTTGGTTAAAGG + Intronic
1130940268 15:88502301-88502323 AGAAAGGAGAAGTTGGGGAATGG - Intergenic
1131062553 15:89412882-89412904 CGAGAGAAGAAGGAGGATTACGG + Intergenic
1131284760 15:91047968-91047990 TAAGAGGAGGAGGAGGGTAAGGG - Intergenic
1132211724 15:100028826-100028848 AAAAAGGAGAAGGAGGGTAAAGG - Intronic
1132336013 15:101049230-101049252 TGAGAGGAGAAGAAGGGAAAAGG + Intronic
1132443416 15:101892034-101892056 AGAGAGAAGAAGGAGAGTAAAGG - Intergenic
1132715101 16:1286217-1286239 CGAGAGGAGCAGAAGGGTCTCGG + Intergenic
1133823854 16:9260031-9260053 GGGGAGGAGAAGTGGGGTCAGGG - Intergenic
1135942460 16:26834331-26834353 GGAGAGGAGAAGGAGGGGGAGGG + Intergenic
1136171629 16:28493414-28493436 GGAGGGGAGAAGGAGGGTATGGG + Intronic
1136176500 16:28520738-28520760 CAATAGGAGAATTAGGGGAACGG - Intergenic
1136902185 16:34051166-34051188 GGAGAGAAGAAGTAGGGCAGTGG + Intergenic
1138530150 16:57630429-57630451 CGAGAGGAGAGGAAGGGCAAGGG - Intronic
1140602234 16:76491123-76491145 AAAGAGGAGAAGAAGGGCAAGGG - Intronic
1140636300 16:76918691-76918713 GGAGAGGAGATGTAGAGGAAAGG + Intergenic
1140662315 16:77199220-77199242 CAAGGGCAGAACTAGGGTAATGG - Exonic
1141329646 16:83098298-83098320 CCAGAGGAGCAGTAGTGCAAAGG - Intronic
1143238728 17:5425744-5425766 CAAGAGGTGAAGTAGGCTAAGGG - Intronic
1143481714 17:7230977-7230999 GGAGAGGAGAAATAAGGAAAGGG - Intronic
1145256248 17:21324038-21324060 CCAGAAGAGAAGTCGGGTAGGGG + Intergenic
1145320365 17:21763912-21763934 CCAGAAGAGAAGTCGGGTAGGGG - Intergenic
1148850383 17:50551734-50551756 GGAGGGGAGAAGTAGGGCAGAGG - Intronic
1149378869 17:56072815-56072837 GGAGAGGAGAAGGTGGGGAAAGG + Intergenic
1153051219 18:905045-905067 CGGGAGGAGTTGAAGGGTAAGGG + Intronic
1155116947 18:22778190-22778212 CCAGAGTTGAAGTAGGGCAAAGG + Intergenic
1155272059 18:24150240-24150262 CAAGAGGAGAAGCAAGGCAAAGG + Intronic
1157547156 18:48554607-48554629 AGAGAGGAGAACTTGGGAAAGGG - Intronic
1159280755 18:66281442-66281464 CTACAGGGCAAGTAGGGTAAGGG + Intergenic
1160641508 19:141128-141150 AGAGAGAAGAAGGAGAGTAAAGG + Intergenic
1160820303 19:1054750-1054772 TGAGGGGAGATGTAGGGTCAGGG - Intronic
1162746646 19:12802260-12802282 CAGCAGGAGAAGTAGGGCAACGG - Intronic
1163504119 19:17694548-17694570 AGAGATGAGAAGCAGGTTAATGG - Intergenic
1164441710 19:28284525-28284547 AAAGAGGAGAAGAAGGGTGAAGG + Intergenic
1165144657 19:33723746-33723768 CGAGAGGAGAAGCAGAGGCAAGG - Intronic
1166803325 19:45470938-45470960 CGAGAGGAGACGGTGAGTAAGGG + Exonic
1166816119 19:45547230-45547252 CGAGGGGAGAAGTTAGGTGAGGG - Intronic
925594528 2:5542369-5542391 CGAGATGAGAAATTGGTTAATGG + Intergenic
927284844 2:21345978-21346000 CTAGAGAAGAAGTGGGGTGAAGG - Intergenic
928261635 2:29772676-29772698 TGAGAGGAGATGGAGGGTAAGGG + Intronic
929974672 2:46620935-46620957 GGATAGGGGAAGTAGGGGAAAGG - Intronic
932955994 2:76351437-76351459 TGTTAGCAGAAGTAGGGTAAAGG + Intergenic
935230268 2:101089990-101090012 GGAGAGGAGAAGAAGGGGAGAGG + Intronic
935505162 2:103891401-103891423 GGAGATGAGAAGTAAGGTAGGGG - Intergenic
935565626 2:104603769-104603791 AGAGAGGAGAGACAGGGTAATGG - Intergenic
936169665 2:110157628-110157650 AGAGAGGAGGAGTGGGGTATAGG - Intronic
937475934 2:122215240-122215262 AGAGAGGAGGAGGAGGGTAATGG + Intergenic
937716575 2:125039246-125039268 CCAGAGGAGAGGTATTGTAATGG + Intergenic
938090391 2:128427496-128427518 CCAGAAGGGAAGGAGGGTAAGGG + Intergenic
938642121 2:133292016-133292038 GGAGAGTGGAGGTAGGGTAATGG + Intronic
939566365 2:143790640-143790662 GGAGAGGAGAAGAAAGATAATGG + Intergenic
940041799 2:149369079-149369101 CCAGAGGAGAAATAGGGTGAAGG + Intronic
941038478 2:160593328-160593350 CAAGAGGACAAGTAGGTAAATGG - Intergenic
941373413 2:164696611-164696633 CAAGAGGAAAAGTAGTGCAAGGG - Intronic
943302732 2:186223757-186223779 GGAAAGGAGAAGAAGAGTAAAGG + Intergenic
943596013 2:189857592-189857614 CGAGAGAAGAAGAAAGGAAAAGG - Intronic
944450812 2:199840495-199840517 AGAGATGAGAGGTGGGGTAAGGG + Intronic
944718719 2:202402110-202402132 CAAGAGGAGCAGTTGGGGAAGGG + Intronic
945882637 2:215342419-215342441 CATTAGGAGAAATAGGGTAACGG - Intronic
947100713 2:226618339-226618361 AGAGAGGAGAAAGAGGGTAATGG - Intergenic
948358156 2:237397169-237397191 GGAGAAGAGAAGGAAGGTAAGGG + Intronic
948622104 2:239242212-239242234 CGAGAGAGGAAGGAGGGGAAGGG + Intronic
1169130699 20:3165168-3165190 TGAGAGGAGAAGCCAGGTAAAGG + Intronic
1170456239 20:16536358-16536380 AGTGAAGAGAAGTAGGTTAATGG + Intronic
1173637510 20:44573583-44573605 GCAAAGGAGAAGTAGGGTAATGG + Intronic
1173806328 20:45927723-45927745 CAAGAGGGGAAGAAGAGTAAGGG + Intergenic
1176913831 21:14600872-14600894 TAAGAGGAGAAGGAGGGTGAGGG + Intronic
1180228850 21:46414379-46414401 CCAGAGGAGAAGGAGGAGAAGGG - Intronic
1181779029 22:25179307-25179329 CGAGAGGAGATGTCGGGCTAAGG - Intronic
1182568284 22:31216081-31216103 AGAGAAGTGAAGTAGGGTAAGGG + Intronic
1182896707 22:33864934-33864956 CAGGAGCAGAAGTAGGTTAAAGG - Intronic
1183084458 22:35478057-35478079 TGAGAGGAGAAGGAGGGAAGTGG - Intergenic
1183256600 22:36766347-36766369 CGAGAGAAGATGAAGGGGAAAGG + Intronic
1184370811 22:44080937-44080959 CGAAAGGAGAGGAAGGGGAATGG + Intronic
949724821 3:7031956-7031978 CTAGAGGACAGGTAGGTTAAGGG - Intronic
955062820 3:55507887-55507909 GGAGAGAAGAAGGAGGGGAAAGG + Intergenic
955635618 3:61026194-61026216 AAAGAGGAGAAATATGGTAAAGG + Intronic
955883939 3:63577558-63577580 TGAGAAGAGAACTAGAGTAATGG + Intronic
956143935 3:66173331-66173353 TGAGAGTAGAGGTAGGGTGAGGG + Intronic
957296332 3:78337546-78337568 AGAGAAGAGAAGTAGAGAAAAGG + Intergenic
957618165 3:82559804-82559826 GAAGAAGAGAAGTAGGGGAAGGG + Intergenic
959957093 3:112251790-112251812 AGAGAGGAGAAGCAGGATCATGG - Intronic
960341991 3:116486013-116486035 AGTGAGGAGAAGCAGGGTCAGGG - Intronic
964023433 3:152042270-152042292 CGGGATGAGAAGTAGGGAAAAGG - Intergenic
965962341 3:174443009-174443031 ATAGAGGAGAAGTAGGATATGGG + Intronic
966879615 3:184342654-184342676 AGAGAGGAGAAACAGGGTATGGG - Intronic
968276609 3:197445190-197445212 CGGGGGGAGAAGCAGGGTAGAGG + Intergenic
969029977 4:4204089-4204111 CGAGAGGAGAGGCAGGGTCAAGG - Intronic
970169422 4:13274988-13275010 GGAGAGGAGAAGTGGGGCAAGGG - Intergenic
972713506 4:41622570-41622592 AGAGAAGAGAAGTGGGGTAAAGG + Intronic
975748969 4:77502996-77503018 CTGGAGGAAAAGTAGTGTAAAGG - Intergenic
976389195 4:84492497-84492519 CGAGAAGAGATGAAGGGCAAAGG + Exonic
976915022 4:90361640-90361662 CGAGAGGCAAAGGAGGGCAAGGG - Intronic
978166854 4:105619660-105619682 CTAAATGAGAAATAGGGTAAAGG + Intronic
978321387 4:107499772-107499794 CAAGAGGAGATGGAGGGCAAGGG - Intergenic
978822504 4:112981564-112981586 TGAGAGGACGAGTAGGGTGATGG + Intronic
981870562 4:149480412-149480434 CTAGAGGCTAGGTAGGGTAATGG - Intergenic
982318152 4:154052006-154052028 GGAAAGGGGAAGTAGGGGAAAGG - Intergenic
982427293 4:155280108-155280130 AGAGAGGAGAAGGAGGAAAAAGG + Intergenic
984703154 4:182831832-182831854 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703168 4:182831880-182831902 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703181 4:182831911-182831933 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703192 4:182831942-182831964 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703203 4:182831973-182831995 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703208 4:182831989-182832011 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703213 4:182832005-182832027 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703218 4:182832021-182832043 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703223 4:182832037-182832059 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703234 4:182832068-182832090 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703245 4:182832099-182832121 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703256 4:182832130-182832152 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703267 4:182832161-182832183 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703278 4:182832192-182832214 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703289 4:182832223-182832245 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703294 4:182832239-182832261 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703305 4:182832270-182832292 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703316 4:182832301-182832323 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703321 4:182832317-182832339 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703334 4:182832365-182832387 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703452 4:182833073-182833095 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703460 4:182833094-182833116 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703528 4:182833296-182833318 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703536 4:182833317-182833339 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703571 4:182833408-182833430 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703583 4:182833448-182833470 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703591 4:182833469-182833491 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703599 4:182833490-182833512 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703610 4:182833516-182833538 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703643 4:182833607-182833629 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703655 4:182833647-182833669 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703663 4:182833668-182833690 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703671 4:182833689-182833711 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703682 4:182833715-182833737 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703748 4:182833902-182833924 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703805 4:182834066-182834088 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703813 4:182834087-182834109 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703859 4:182834215-182834237 GGAGAGGAGAAGGAGGGGAGAGG - Intergenic
984703871 4:182834255-182834277 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703879 4:182834276-182834298 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703887 4:182834297-182834319 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703898 4:182834323-182834345 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984703998 4:182834624-182834646 GGAGAGGAGAAGGAGGGGAGGGG - Intergenic
984885177 4:184443352-184443374 AGAGAGAGGAAGTAGGGCAAGGG - Intronic
985140990 4:186840558-186840580 AGGGAGGAGAAGGAGGGGAAGGG - Intergenic
988229603 5:28457789-28457811 CAAGAGCAGAAATAGGGTTAAGG - Intergenic
988996871 5:36723360-36723382 GGAGAGGAGAAGAAGAGCAAGGG + Intergenic
989606401 5:43248247-43248269 CAGTAGGGGAAGTAGGGTAAAGG + Intronic
992980441 5:82165267-82165289 CAAAAGGAGAAATAGGGCAAGGG - Intronic
993720359 5:91315840-91315862 TGAAAGGAGAAGAAGGGGAAGGG + Intergenic
996651226 5:125879505-125879527 GGAGAGGAGATGGAGGGGAAAGG - Intergenic
997630700 5:135366688-135366710 CCTGGGGAGAAGTAGGGTGAGGG + Intronic
997854123 5:137358129-137358151 AGGGAGGAGGAGTAGAGTAAAGG + Intronic
998181700 5:139950540-139950562 CCAGAGTAGGAGGAGGGTAAAGG + Intronic
998469950 5:142375795-142375817 GCAGAGGAGAAGCAGGGCAAAGG - Intergenic
1000492925 5:161937757-161937779 AGACAGGAGAGGTAGGGAAAGGG - Intergenic
1002735348 5:181383360-181383382 AGAGAGAAGAAGGAGAGTAAAGG - Intergenic
1002749172 6:90767-90789 AGAGAGAAGAAGGAGAGTAAAGG + Intergenic
1004002069 6:11604863-11604885 GGAGAGGAGAAGGGGGGTAGGGG + Intergenic
1004175182 6:13333598-13333620 CAAGAGGAGAAGGAGGGCGATGG + Intergenic
1012529249 6:100214410-100214432 GGAGAGTAGGAGGAGGGTAAGGG + Intergenic
1013300679 6:108802474-108802496 TGAGAGGACAATTAGGGTGATGG - Intergenic
1014726713 6:124979818-124979840 CAAGAGTAGAAGCAGGGAAATGG + Intronic
1015009674 6:128330315-128330337 CGATATGAAAAGGAGGGTAATGG - Intronic
1017567627 6:155705180-155705202 GGAGAGAAGAAGCAGGGCAAGGG + Intergenic
1017652622 6:156597297-156597319 CTAGAGGAGAAATAGGGGAATGG - Intergenic
1019239615 6:170655671-170655693 AGAGAGAAGAAGGAGAGTAAAGG - Intergenic
1020080091 7:5282416-5282438 GGAGAGCAGGAGGAGGGTAATGG + Intronic
1020787581 7:12590429-12590451 GGGGAGGAGAAATAGGGTGAAGG + Intronic
1022577778 7:31515202-31515224 CTAGTGGAGAAGTAGTGGAAAGG - Intronic
1025198830 7:56949800-56949822 GGAGAGCAGGAGGAGGGTAATGG - Intergenic
1025673116 7:63627133-63627155 GGAGAGCAGGAGGAGGGTAATGG + Intergenic
1026800635 7:73397837-73397859 AGGGAGGAGGAGTAGGGGAAAGG + Intergenic
1027761533 7:82285156-82285178 CGAGAAGAGGAGGAGGGCAAGGG - Intronic
1029788318 7:102816097-102816119 GGAGAGCAGAGCTAGGGTAAGGG - Intronic
1030698887 7:112617024-112617046 CCAGAGGGGAAGCAGGGTCAAGG + Intergenic
1031146823 7:118005937-118005959 CTACAGGAGAAGTAGGGTACAGG + Intergenic
1034429240 7:151032881-151032903 AGGGAGGGGAGGTAGGGTAATGG + Intronic
1035508160 8:150934-150956 AGAGAGAAGAAGGAGAGTAAAGG + Intergenic
1038477929 8:27881527-27881549 GGAGGGGAGAAGAGGGGTAAGGG + Intronic
1038489007 8:27956148-27956170 AGAGAAGAGGAGGAGGGTAAGGG + Intronic
1038530163 8:28312026-28312048 AAAGAGGTGATGTAGGGTAAAGG + Intergenic
1039494619 8:37971597-37971619 GGAGAGGAGAGACAGGGTAAAGG - Intergenic
1039576138 8:38625513-38625535 CAGGAGGAGAAGAAGGGCAATGG + Intergenic
1041466551 8:58163052-58163074 CCTGAGGAGAAGTAGGGGAGCGG + Intronic
1042591902 8:70404141-70404163 GGAGAGGTGAAGAAGAGTAAGGG + Intergenic
1042945265 8:74147758-74147780 TGAGAGGTGAAGTAAGGCAAGGG - Intergenic
1042956902 8:74260606-74260628 AGAGAGGAGGAGTTGGGAAAAGG + Intronic
1045172591 8:99687250-99687272 GGAGAGGAGAGGGAGAGTAAAGG - Intronic
1045333640 8:101179280-101179302 GGAGAGAAGAAGCAGGGGAAGGG - Intronic
1047316417 8:123738318-123738340 GAAGAGGAGAAGTGGGTTAAAGG - Intergenic
1047370700 8:124253505-124253527 AGAGAGGAGAAGATGGGGAAGGG - Intergenic
1050272897 9:3965154-3965176 ATAGAAAAGAAGTAGGGTAAAGG - Intronic
1050293220 9:4178429-4178451 AGATAGGAGAAGGAGGGGAAGGG + Intronic
1050523660 9:6527244-6527266 CTAGAGGAGAAGCAGGGAGAGGG + Intergenic
1051389715 9:16551285-16551307 AGAAAGTAGAAGTAGGGAAAGGG - Intronic
1052288353 9:26813538-26813560 AAAGAAGAGAAGTAGGGGAAGGG + Intergenic
1053480792 9:38414850-38414872 GGAGAGGAGAGGGAGGGTATGGG + Intronic
1055380089 9:75697249-75697271 TGAGAGCAGAAGTAGGCTGAAGG + Intergenic
1057487880 9:95500211-95500233 TGAGAGGACAGGTTGGGTAATGG - Intronic
1058216089 9:102235555-102235577 GCAGAGGAGAAGGAGAGTAAGGG - Intergenic
1058432466 9:104930855-104930877 AGAGAGGAGATGGAGGGTCAGGG - Intergenic
1058557772 9:106188084-106188106 TGACAGGGGAAGTAGGGCAAAGG - Intergenic
1059206197 9:112468570-112468592 AGAGAGGAGAAAAAGGGAAAGGG - Intronic
1060108701 9:120891268-120891290 GGAGAGGAGAAGAAGGGGAAAGG - Intronic
1060222833 9:121773556-121773578 CGAGAGGAGGAGCATGGTATGGG - Intronic
1060679790 9:125552037-125552059 AGAGAGGAGAAGTAGGGAGTGGG - Intronic
1061014059 9:127971858-127971880 CGAGCAGAGAAGTGGGGGAAGGG + Intronic
1203600271 Un_KI270748v1:6734-6756 AGAGAGAAGAAGGAGAGTAAAGG - Intergenic
1185975885 X:4719583-4719605 TGAGAGCAGAAGAAAGGTAAAGG - Intergenic
1186149161 X:6655865-6655887 GGAGAGGGGAAGTTGGATAAAGG - Intergenic
1186762551 X:12738402-12738424 AGAGAGAGGAGGTAGGGTAAGGG + Intergenic
1186799491 X:13078896-13078918 TGAGAGGAGAGGGAGGGAAAGGG - Intergenic
1186874778 X:13806206-13806228 TGAGATAAGAAGTAGGTTAATGG - Intronic
1187348749 X:18492507-18492529 CTAGAAGAGAAGGAGGTTAAAGG - Intronic
1187596858 X:20782828-20782850 GGAGAGGAGAAGAGGGTTAAAGG + Intergenic
1189369092 X:40413666-40413688 CCAGGGGTGACGTAGGGTAATGG + Intergenic
1190973162 X:55372289-55372311 GGAGAAGAGAAGTTGGTTAATGG - Intergenic
1192021197 X:67393391-67393413 CCAGAGGCTAAGAAGGGTAATGG + Intergenic
1192051095 X:67724575-67724597 GGAGAGGACAAGGAGGGCAATGG + Exonic
1192832773 X:74767700-74767722 AGTGAGGAGAAGTAGGGTGAGGG + Intronic
1194195206 X:90883571-90883593 AGAGAGGAGAAGCAGGATCAGGG + Intergenic
1194948844 X:100100704-100100726 TGAGAGGAGAAGCTGGGTGAAGG + Intergenic
1195103161 X:101575400-101575422 AGAGGGGAGAAGTAGGGAGAGGG - Intergenic
1196990621 X:121324944-121324966 GGAGAGGAGGAGGAGGGTGAGGG + Intergenic
1198674230 X:139115051-139115073 TGACAGGAGAAGTAAGGTAGTGG + Intronic
1199424122 X:147681580-147681602 GGAGAGGGGTAGCAGGGTAAAGG + Intergenic