ID: 1120129533

View in Genome Browser
Species Human (GRCh38)
Location 14:80788723-80788745
Sequence CCGAGAGGAGAAGTAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129533_1120129538 -5 Left 1120129533 14:80788723-80788745 CCTTACCCTACTTCTCCTCTCGG 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129533_1120129541 10 Left 1120129533 14:80788723-80788745 CCTTACCCTACTTCTCCTCTCGG 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1120129541 14:80788756-80788778 AATTTAGGCTATTTTACTTATGG 0: 1
1: 0
2: 3
3: 17
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129533 Original CRISPR CCGAGAGGAGAAGTAGGGTA AGG (reversed) Intronic
901638742 1:10682467-10682489 CCGAGAGGGGAAGTAGAGGAGGG + Intronic
902902442 1:19528594-19528616 CAGAGAGGTGAAGTTGGCTAAGG + Intergenic
903023278 1:20409525-20409547 CTTAGAGGATAAGTAGGGTTTGG + Intergenic
905150055 1:35920261-35920283 CAGGGAGGAGAAGTAAGGTGGGG - Exonic
906147980 1:43571159-43571181 CCGAGAGGACAAGGAGGATGGGG - Intronic
906848086 1:49216401-49216423 TAGAGAGGGGAAGGAGGGTAGGG - Intronic
907387501 1:54135716-54135738 CTGAGAAGAGAAGGAGGGTAGGG - Intronic
909866220 1:80675559-80675581 CTGAGAGGTGAAGTAGGACAGGG + Intergenic
910364676 1:86452128-86452150 CTGGGAGGAGAAGCAGGATAAGG - Intronic
910859850 1:91732649-91732671 GAGAGAGGAGCAGTAGGGAAAGG - Intronic
912313389 1:108645334-108645356 GCCAGATGAGAAGGAGGGTAAGG + Intergenic
913004105 1:114611331-114611353 CCGAGGAGTGAAGTAGGGTATGG - Intronic
913257024 1:116963031-116963053 CCGAGAGGGGAAGGAAGCTAGGG - Intronic
916316170 1:163450581-163450603 CTGAGTGGAGAAGGAGAGTATGG + Intergenic
916702379 1:167311030-167311052 AAGAGAGGAGAAAGAGGGTAGGG + Intronic
917634072 1:176918227-176918249 CAGAGAAGAGAAGTAGGCTCAGG - Intronic
921570307 1:216770018-216770040 CTGAGAAGTGAATTAGGGTAGGG + Intronic
921572517 1:216796258-216796280 CCCAGTGGGGAAGTGGGGTAAGG - Intronic
1063529765 10:6819701-6819723 AGGAGAGGAGAAGGAGGGCAGGG + Intergenic
1064038859 10:11940352-11940374 CAGAGAAGAGAAGCAGGGTCAGG - Intronic
1065197037 10:23276542-23276564 CCAAGAGGAGAGCTCGGGTAAGG - Intronic
1068162904 10:53289690-53289712 GTGAGAGGACAAGTAAGGTAAGG + Intergenic
1069834536 10:71300468-71300490 CAGAGAGATGAAGTAGGGGAGGG + Exonic
1071073726 10:81727007-81727029 TATAGATGAGAAGTAGGGTAGGG - Intergenic
1079333440 11:19551868-19551890 AGGAGAGGAGAAGGAGGGGAAGG - Intronic
1081608280 11:44541459-44541481 CTGAGAGGAGAAGGATTGTAGGG + Intergenic
1083048074 11:59754480-59754502 CCAAGAAGACAAATAGGGTAGGG + Intronic
1084104866 11:66974962-66974984 CCTAGAGGAGAAGGAGGAGAAGG + Intergenic
1086104258 11:83132232-83132254 CCCAGAGAAGAATTAGGGGAAGG + Intergenic
1086528578 11:87757506-87757528 GCAAGAAGAGAAGAAGGGTACGG + Intergenic
1086839449 11:91667163-91667185 CAGTGAGGAGAAGCAGGGTCAGG - Intergenic
1088524217 11:110735217-110735239 CTGAGAGGAGAAGCAGAGGAGGG + Intergenic
1090320272 11:125837216-125837238 AGGAGAGGAGATTTAGGGTAGGG - Intronic
1091332954 11:134744771-134744793 GCGGGAGGAGAAGGAGGGAATGG + Intergenic
1093127298 12:15345923-15345945 CAGAGGGGAAAAGTAGGGGAGGG - Intronic
1095698352 12:45165380-45165402 CAGTGAGGAGAAGCAGGGTTAGG + Intergenic
1095938817 12:47712548-47712570 CCTGGAGGAGAAGGAGGGTCTGG - Exonic
1098145152 12:67490096-67490118 CAGTGAGGAGAAGTAGGATCAGG - Intergenic
1098974102 12:76884219-76884241 CTAAGAGGTCAAGTAGGGTAAGG - Intergenic
1101209875 12:102525066-102525088 TGGAGAGGAGATGGAGGGTAAGG + Intergenic
1101954236 12:109199375-109199397 GAGAGAGGAGGAGTCGGGTAGGG - Intronic
1104899491 12:132180968-132180990 CCGAGGGGAGAGCTGGGGTAGGG + Intergenic
1104927112 12:132319561-132319583 CCAAGAGGAGATGTAGGGTGAGG - Intronic
1109376176 13:61496177-61496199 ACGAGAGGAGGAGAATGGTAGGG - Intergenic
1113928710 13:113954997-113955019 CAGAGAGGAGGAGTAGGATCTGG + Intergenic
1113928715 13:113955020-113955042 CGGAGAGGAGGAGTAGGATCTGG + Intergenic
1113928831 13:113955701-113955723 CGGAGAGGAGGAGTAGTGTCTGG + Intergenic
1113928879 13:113955993-113956015 CAGAGAGGAGGAGTAGGATCTGG + Intergenic
1113928884 13:113956016-113956038 CGGAGAGGAGGAGTAGGATCTGG + Intergenic
1113928892 13:113956059-113956081 CGGAGAGGAGGAGTAGGATCTGG + Intergenic
1113928901 13:113956105-113956127 CGGAGAGGAGGAGTAGGATCTGG + Intergenic
1115220998 14:31058325-31058347 CCGAGAGGAAAAGAAGGTTAAGG - Intronic
1115319726 14:32066739-32066761 ACTAGTGGAGAAGTGGGGTAGGG + Intergenic
1115447037 14:33502448-33502470 CAGAGAGCAGAAGTCGGGTCAGG - Intronic
1117253296 14:53955347-53955369 CCGAGAGGATAGGAAGGGGAAGG + Intronic
1120129533 14:80788723-80788745 CCGAGAGGAGAAGTAGGGTAAGG - Intronic
1121447468 14:93988031-93988053 CAGAGAGGAGAAGAGGGGTGGGG + Intergenic
1122094530 14:99361556-99361578 CAGAGTGGAGAAGAAGGGGACGG + Intergenic
1123480356 15:20625389-20625411 CCTGGAGGAGAAGCAGGGAAAGG - Intergenic
1123637652 15:22374976-22374998 CCTGGAGGAGAAGCAGGGAAAGG + Intergenic
1124350727 15:28953817-28953839 CCGAGCGGAGAAGAGGGGCATGG - Intronic
1125102670 15:35932950-35932972 GGGAGTGGAGCAGTAGGGTAAGG + Intergenic
1126466394 15:48964910-48964932 CCAGGAGGAGATGTAGGGCAGGG - Intergenic
1129542651 15:76363459-76363481 CAGAGAGGAGGGGTAGGGTAGGG + Intronic
1130112480 15:80977179-80977201 AGGAGAGGAGAAATAGAGTAAGG - Exonic
1130741606 15:86606597-86606619 AAGAGAGGAGGAGTAGGGTCTGG - Intronic
1131629778 15:94164563-94164585 CAGAGAGGAGAAGAAGGAGAAGG - Intergenic
1134028752 16:10975040-10975062 CAGTGAGGAGAAGTAGAGGAGGG + Intronic
1134562577 16:15223381-15223403 CCAAGAGAAGGAGTAGGGAAAGG - Intergenic
1134923117 16:18135008-18135030 CCAAGAGAAGGAGTAGGGAAAGG - Intergenic
1134933985 16:18230717-18230739 GCGGGAGGAGAAGGAGAGTAGGG + Intergenic
1135654807 16:24238629-24238651 CTGAGAGGAAAGGTAGGGTTTGG + Intergenic
1135727701 16:24869791-24869813 CAGAGAAGAGAAGTAGAGGAAGG - Intronic
1136171628 16:28493413-28493435 GGGAGGGGAGAAGGAGGGTATGG + Intronic
1138075432 16:54037964-54037986 CTAAGATGAGAAGTAGTGTAGGG - Intronic
1138530151 16:57630430-57630452 GCGAGAGGAGAGGAAGGGCAAGG - Intronic
1138807779 16:60111372-60111394 CTGAGAGGAGAAGTAGGGAAAGG - Intergenic
1139371742 16:66473356-66473378 CCGAGTGCAGAAGTGGGGCAGGG - Intronic
1141417538 16:83887983-83888005 CAGAGATGAGAAGAAGGGAAGGG - Intergenic
1143238729 17:5425745-5425767 ACAAGAGGTGAAGTAGGCTAAGG - Intronic
1144689364 17:17250059-17250081 CTGGGAGGAGAAGGAGGGAATGG - Intronic
1145256246 17:21324037-21324059 CCCAGAAGAGAAGTCGGGTAGGG + Intergenic
1145320367 17:21763913-21763935 CCCAGAAGAGAAGTCGGGTAGGG - Intergenic
1146307680 17:31743089-31743111 CCCAGAGGAAAATTAGGGTATGG + Intergenic
1146522641 17:33538207-33538229 GAGACAGGAGAAGCAGGGTATGG + Intronic
1146930373 17:36772838-36772860 ATGAGAGGACATGTAGGGTAGGG - Intergenic
1147927609 17:43955138-43955160 CTGAGAGGCGGAGTAGGGGAAGG + Intronic
1148464214 17:47855432-47855454 CCCAGTGGAGAAGTGGGGTAGGG - Intronic
1148493516 17:48037945-48037967 GGGAGAGGAGAAGTGGGGGAAGG - Intronic
1148721218 17:49754641-49754663 TAGAGAGGAGAAGAAGGGGAGGG + Intronic
1153711869 18:7808299-7808321 CACAGAGGAGAAGCAGGGTGGGG + Intronic
1155007646 18:21742100-21742122 CCAAGAGGAGGAGTCGGGTTGGG - Intronic
1156193571 18:34747491-34747513 CTCAGAGGAGAAGGATGGTAGGG - Intronic
1157276099 18:46312020-46312042 CAGAGAGCAGAAGTTGGGTGTGG + Intergenic
1157547157 18:48554608-48554630 CAGAGAGGAGAACTTGGGAAAGG - Intronic
1159280754 18:66281441-66281463 CCTACAGGGCAAGTAGGGTAAGG + Intergenic
1159564001 18:70027068-70027090 TAGAAAGGAGAAGGAGGGTAGGG - Intronic
1159915402 18:74183195-74183217 AGGAGAGGAGAAGTAGGGGGAGG - Intergenic
1160955105 19:1687613-1687635 CCAAGAGGAGAAGAAGAGTGGGG + Intergenic
1161075677 19:2284313-2284335 CCGGGTGGAGGAGCAGGGTAAGG + Intronic
1161485230 19:4531878-4531900 CAGAGAGGGGAAGTAGGTTGAGG - Intronic
1161909736 19:7184263-7184285 CCGAGAGGAGAAGGAACGTGGGG - Intronic
1164160806 19:22624260-22624282 CCCAGAGGAGAAATATGGCAGGG + Intergenic
1164537753 19:29099043-29099065 CAGAGAGGAGTGGTAGGGCAGGG - Intergenic
1166318407 19:42001909-42001931 CCGAGAAGAGAAGCAGTCTAAGG + Intronic
1166669416 19:44701122-44701144 AAGAGAGGAAAAGTAGGGGAAGG - Intronic
1166803324 19:45470937-45470959 CCGAGAGGAGACGGTGAGTAAGG + Exonic
926801752 2:16665647-16665669 CCGGGAGGAGAAGGATGGCAGGG + Intronic
928120296 2:28579105-28579127 CAGAGAGGCTGAGTAGGGTAAGG - Intronic
928261634 2:29772675-29772697 CTGAGAGGAGATGGAGGGTAAGG + Intronic
929052434 2:37849461-37849483 CCATGAGTAGAAGTAGGATATGG + Intergenic
931229506 2:60362395-60362417 CAGGGAGGAGGAGTAGGGAACGG + Intergenic
935505163 2:103891402-103891424 AGGAGATGAGAAGTAAGGTAGGG - Intergenic
936067492 2:109343518-109343540 CCAGGAGGAGAAGTGGGGAAGGG - Intronic
938090389 2:128427495-128427517 CCCAGAAGGGAAGGAGGGTAAGG + Intergenic
940136813 2:150446446-150446468 CAGAGAGGAGAGGTACGGGATGG - Intergenic
941143493 2:161814764-161814786 CAGAGAGGAGAGGGAGGGTGGGG + Intronic
942607758 2:177710144-177710166 CCCAGAGGAGAAGCAAGGAAGGG + Intronic
944718718 2:202402109-202402131 CCAAGAGGAGCAGTTGGGGAAGG + Intronic
948440493 2:237984080-237984102 CAAAGAGGAGGAGTAGGGGAGGG - Intronic
948537328 2:238655852-238655874 CCCAGAGGAGGAGGAGTGTAAGG + Intergenic
1170066465 20:12316080-12316102 CTGAGAGGAGAAGGTGGGCATGG - Intergenic
1173751242 20:45478454-45478476 GGGCGAGCAGAAGTAGGGTAGGG - Intronic
1174566643 20:51469514-51469536 CAGGGAGGAGGAGTCGGGTAGGG - Intronic
1178610148 21:34073220-34073242 CCGGGAGGAGAAGGAAGGCATGG + Intronic
1180228852 21:46414380-46414402 CCCAGAGGAGAAGGAGGAGAAGG - Intronic
1182568283 22:31216080-31216102 AAGAGAAGTGAAGTAGGGTAAGG + Intronic
1183301649 22:37061772-37061794 CTGAGAGGAGAAGAAAGTTAGGG + Intronic
1183345310 22:37304188-37304210 CCCAGAGGAGAAGCCGGGAAAGG + Intronic
1183863371 22:40685036-40685058 TCGAGGGGAGAAGTGGGGCAGGG + Intergenic
949100085 3:133033-133055 CAGGGAGGAGCAGTAGGGGATGG - Intergenic
949416341 3:3818884-3818906 CAATGGGGAGAAGTAGGGTAAGG + Intronic
949516910 3:4815608-4815630 ACGGGAGGAGAAGTAGTGAACGG + Intronic
950569922 3:13793490-13793512 CCGAGGGGAGAAGAATGGTCAGG - Intergenic
951543939 3:23806930-23806952 CCGGGAGGCGAAGGAGGGCAGGG - Intronic
952599365 3:35060832-35060854 CCTAGGGGAGAGGTAGGATAAGG - Intergenic
954409853 3:50365736-50365758 CTCAGAAGAGAAGTAGGGCATGG - Intronic
958424048 3:93961233-93961255 TTGAGAGGAGAAGCAGGGAAAGG + Intronic
959029030 3:101276074-101276096 CAGAGAGGAGAAGTGGGTAAAGG + Intronic
961624121 3:128247783-128247805 CAGAGAGGAGAAGGAGGAGAAGG + Intronic
965962340 3:174443008-174443030 GATAGAGGAGAAGTAGGATATGG + Intronic
966879616 3:184342655-184342677 GAGAGAGGAGAAACAGGGTATGG - Intronic
970169423 4:13274989-13275011 AGGAGAGGAGAAGTGGGGCAAGG - Intergenic
972162105 4:36239608-36239630 CAGAGAGGAGAAGAGAGGTAAGG + Intronic
974298482 4:60034799-60034821 CAGGGAGCAGAAGCAGGGTAGGG - Intergenic
975647081 4:76555816-76555838 CCCAGAGGTGGGGTAGGGTAGGG - Intronic
980330458 4:131403842-131403864 GGGCGAGTAGAAGTAGGGTAGGG - Intergenic
983628400 4:169826108-169826130 CAGTGAGGAGTAGTAGGGAAAGG + Intergenic
984703169 4:182831881-182831903 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703335 4:182832366-182832388 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703453 4:182833074-182833096 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703461 4:182833095-182833117 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703529 4:182833297-182833319 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703537 4:182833318-182833340 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703584 4:182833449-182833471 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703592 4:182833470-182833492 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703600 4:182833491-182833513 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703611 4:182833517-182833539 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703656 4:182833648-182833670 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703664 4:182833669-182833691 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703672 4:182833690-182833712 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703683 4:182833716-182833738 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703806 4:182834067-182834089 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703814 4:182834088-182834110 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703872 4:182834256-182834278 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703880 4:182834277-182834299 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703888 4:182834298-182834320 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703899 4:182834324-182834346 GGGAGAGGAGAAGGAGGGGAGGG - Intergenic
984703999 4:182834625-182834647 AGGAGAGGAGAAGGAGGGGAGGG - Intergenic
991057300 5:62334540-62334562 ACGAGAGGAGGAGTAGGAGAAGG - Intronic
993720358 5:91315839-91315861 CTGAAAGGAGAAGAAGGGGAAGG + Intergenic
994425558 5:99580674-99580696 TCTAGAGGAGAAATTGGGTATGG + Intergenic
994435783 5:99731567-99731589 TCTAGAGGAGAAATTGGGTATGG - Intergenic
997392221 5:133526480-133526502 CCTATTGGAGAGGTAGGGTAAGG + Intronic
997630698 5:135366687-135366709 CCCTGGGGAGAAGTAGGGTGAGG + Intronic
1002426932 5:179182051-179182073 CCTCGAGGAGGAGTAGGGTTTGG - Intronic
1003264413 6:4552757-4552779 CCCAGAGGAGAGGTAGGGTGTGG - Intergenic
1003370712 6:5523321-5523343 GGGAGAAGAGAAGTAGGGCAAGG + Intronic
1004002068 6:11604862-11604884 GGGAGAGGAGAAGGGGGGTAGGG + Intergenic
1006278195 6:33022839-33022861 CCCAGTGAAGCAGTAGGGTAAGG + Intergenic
1008484572 6:52021770-52021792 CAAAGAGGAGAAGGAGGGGAAGG - Intronic
1010725911 6:79332916-79332938 CAGAAGGGAGAAGTATGGTATGG + Intergenic
1011962495 6:93108256-93108278 GCTAGAGGAAAGGTAGGGTATGG - Intergenic
1014100829 6:117509755-117509777 CCACCAGGAGGAGTAGGGTAGGG - Intronic
1014607709 6:123498527-123498549 CCCACAGGAGAGGTAGGGAATGG + Intronic
1017602075 6:156094657-156094679 CGCAGAAGAGAAGTAGGGGAAGG - Intergenic
1018088547 6:160325924-160325946 CCTGGAGGAGAAGCAGGGTGGGG - Intergenic
1020273804 7:6613062-6613084 CAGAGAGGAGAAGGAGGGATGGG + Intergenic
1023218536 7:37893557-37893579 CCAAGTGGACAAGTAGGGAAAGG - Intronic
1023362864 7:39433326-39433348 CAAAGAGGAGAAGCTGGGTAAGG - Intronic
1023913288 7:44570152-44570174 CCCAGAGGAGAGGAAGGGTCCGG - Intronic
1026503261 7:70960582-70960604 GCCAGAGGAGAAGGAGGGTGGGG + Intergenic
1030118758 7:106085140-106085162 GAGAGAGGAGAAATAGGGTAGGG + Intergenic
1037805209 8:22055018-22055040 CGGAGGGGAGAAGGAGGGGAGGG - Intronic
1039018225 8:33176725-33176747 CCCAGAGGCCAAGAAGGGTAGGG + Intergenic
1043103857 8:76083152-76083174 CCTAGTGGAGAAATGGGGTATGG - Intergenic
1048606154 8:135970920-135970942 TAGAGAGGAGAAGGAAGGTAAGG - Intergenic
1053480791 9:38414849-38414871 CGGAGAGGAGAGGGAGGGTATGG + Intronic
1055770604 9:79713207-79713229 CAGAGAGGAGAATGAGGGGAAGG + Intronic
1056496402 9:87159790-87159812 CCCAGAGGAGAAGTGAGGGATGG + Intergenic
1057595564 9:96413470-96413492 CAGAAAGGGGAAGTAGGATACGG + Intronic
1057610994 9:96543650-96543672 CAAAAAGGAGAAGCAGGGTAGGG - Intronic
1057860994 9:98640690-98640712 TGGAGAGGAGGAGGAGGGTAAGG + Intronic
1058034667 9:100237648-100237670 CGGTGAGCAGAAGCAGGGTAGGG - Intronic
1058624613 9:106921746-106921768 GCGAAAGGAGAAGTGGGGTGGGG + Intronic
1058886768 9:109327552-109327574 CCCAAAGGAGAAGGAGGATATGG - Intergenic
1060222834 9:121773557-121773579 CCGAGAGGAGGAGCATGGTATGG - Intronic
1060679791 9:125552038-125552060 CAGAGAGGAGAAGTAGGGAGTGG - Intronic
1060933584 9:127503628-127503650 TCGAGAGGAGAGGTCAGGTAGGG + Intergenic
1062153704 9:135034241-135034263 CGGAGAGGAGAGGCAGGGGATGG - Intergenic
1062153738 9:135034348-135034370 CGGAGAGGAGAGGCAGGGGACGG - Intergenic
1186799492 X:13078897-13078919 CTGAGAGGAGAGGGAGGGAAAGG - Intergenic
1187367056 X:18674596-18674618 CTGGGAGGAGAGGTGGGGTAGGG + Intergenic
1187367077 X:18674671-18674693 CCGACATGAGAAGTAGTGGAGGG - Intergenic
1188124828 X:26354367-26354389 CCAAGAGTAGAAGGAGGATAAGG - Intergenic
1190110741 X:47587487-47587509 GTGAGGGGAGAAGTAGGGGAGGG - Intronic
1192832772 X:74767699-74767721 CAGTGAGGAGAAGTAGGGTGAGG + Intronic
1193585028 X:83311016-83311038 AGGAGAGGAGAAGAAAGGTAGGG + Intergenic
1194195205 X:90883570-90883592 CAGAGAGGAGAAGCAGGATCAGG + Intergenic
1195514700 X:105760492-105760514 CAGAGAGTAGAGGTAGGGAATGG - Intronic
1197726833 X:129782045-129782067 CCAAGAGGAGAAGCAGGGGCAGG - Intronic
1198516760 X:137416402-137416424 CTAAAAGCAGAAGTAGGGTAGGG + Intergenic
1198778873 X:140212523-140212545 AGGAGAGGAGAAATAGTGTAGGG + Intergenic
1199649995 X:149940554-149940576 GCAAGAGGAGAAGTTGGGGACGG + Intergenic