ID: 1120129535

View in Genome Browser
Species Human (GRCh38)
Location 14:80788728-80788750
Sequence GTTGACCGAGAGGAGAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129535_1120129538 -10 Left 1120129535 14:80788728-80788750 CCCTACTTCTCCTCTCGGTCAAC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129535_1120129541 5 Left 1120129535 14:80788728-80788750 CCCTACTTCTCCTCTCGGTCAAC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1120129541 14:80788756-80788778 AATTTAGGCTATTTTACTTATGG 0: 1
1: 0
2: 3
3: 17
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129535 Original CRISPR GTTGACCGAGAGGAGAAGTA GGG (reversed) Intronic
908991839 1:70100799-70100821 GTTAAGAGAGAGGAGAAGTGAGG - Intronic
909421247 1:75468635-75468657 GTTGATAGAGAGGAGAAGGATGG + Intronic
912334055 1:108846268-108846290 GCTGACCGAGAGGAGAGTAAAGG - Intronic
920711094 1:208295826-208295848 GGAGACAGAGAGGAGAAGAAAGG - Intergenic
921600666 1:217103194-217103216 GTTGATCGAGAGTAGAGGAATGG + Intronic
921760011 1:218902258-218902280 GGTGACCAAGAAGAGAAGTAAGG - Intergenic
921810354 1:219505443-219505465 GTTGATGGAGTGGAGATGTAAGG + Intergenic
922920728 1:229300621-229300643 GTGGAGCCAGAGGAGAAGCAGGG + Intronic
923977567 1:239281311-239281333 GCTGAGCAAGAGGAAAAGTAAGG + Intergenic
1064038860 10:11940357-11940379 GTGGACAGAGAAGAGAAGCAGGG - Intronic
1077139160 11:1015995-1016017 GTGGACTGAGAGGAGAAGGCAGG + Exonic
1080595804 11:33773922-33773944 GGTGAGCGAGAGGAGAAGATAGG - Intronic
1080804670 11:35641555-35641577 GATGACTGAGGGGAGAAGGAGGG - Intergenic
1084948626 11:72652539-72652561 ATTGACAGAGAGGAGAAGGAGGG - Intronic
1085453798 11:76654734-76654756 GATGACCAAGAAGAGAAGAATGG + Intergenic
1087746156 11:101949743-101949765 GGTGACTGAGAGGTTAAGTAAGG + Intronic
1088330154 11:108642964-108642986 GTTGACAGAGAGGAGAGAGATGG + Intergenic
1093949175 12:25144979-25145001 GTTGAGGGAGAGGAGAAAAAGGG - Intronic
1098239104 12:68448029-68448051 GGTGTCAGAGAAGAGAAGTAAGG - Intergenic
1103340611 12:120219356-120219378 GATGACCGAGAGGGGAAGTGTGG - Intronic
1103799817 12:123530913-123530935 GTCTACTGAGAGGAGGAGTAGGG + Intronic
1106310923 13:28553554-28553576 GGTGACCTAGAGGAGTAGGAAGG + Intergenic
1110981386 13:81903747-81903769 GTTGACAGGGAGTAGAAGTAGGG + Intergenic
1120086851 14:80285416-80285438 ATGGACAGAGAGGAGAAGGATGG + Intronic
1120129535 14:80788728-80788750 GTTGACCGAGAGGAGAAGTAGGG - Intronic
1122361359 14:101168290-101168312 CTAGAAGGAGAGGAGAAGTAAGG - Intergenic
1202926208 14_KI270724v1_random:28400-28422 GCTGACCCAGCGGAGAAGGAGGG - Intergenic
1124350729 15:28953822-28953844 GTGGACCGAGCGGAGAAGAGGGG - Intronic
1124357064 15:29003604-29003626 GTTGAGCCAGAGAAGCAGTAAGG + Intronic
1125896015 15:43302253-43302275 CTTGACCGACAGGAGAAGGAGGG - Exonic
1129167599 15:73787587-73787609 ATTGACCAAGCTGAGAAGTAGGG - Intergenic
1135553153 16:23413786-23413808 GATGCCCAAGAGGAGAAGGAAGG + Intronic
1135823947 16:25709673-25709695 TTTAACCGAGAGGGGAAGAATGG + Intronic
1141449421 16:84087690-84087712 GTTGACAGGGAGGAGAAGAAAGG - Intronic
1141659204 16:85432756-85432778 GTTGACAGATAGGAAAAGCAAGG + Intergenic
1156361653 18:36389258-36389280 GTTGACCTAAGGGAGAAGAAAGG - Intronic
1157303388 18:46497358-46497380 TTTGACCGTGAGGAGATGGAAGG + Intronic
1157547158 18:48554613-48554635 GCTGACAGAGAGGAGAACTTGGG - Intronic
1158034335 18:53006354-53006376 ATTGACCCAGAGGAGAGGAATGG - Intronic
1158549641 18:58424507-58424529 GTTGCCCTGGAGGAGAAGTCTGG + Intergenic
1159744199 18:72211013-72211035 GTTGGCGGAAAGGAGAAGCAGGG + Intergenic
1160392378 18:78543969-78543991 GTTGACTAAGAGGACATGTAAGG - Intergenic
1167311709 19:48740822-48740844 GTTCCCCGAGAGGAGAGGTCTGG - Intergenic
1167751360 19:51382309-51382331 GTTGAGTGTGAGGAGGAGTAAGG + Intronic
932933893 2:76078652-76078674 ATTGTCCTAGAGGAGAACTAAGG + Intergenic
937755538 2:125533530-125533552 GTTGACTTTGAGGAGAATTAAGG + Intergenic
939150797 2:138470258-138470280 GTTGACAGAGTGGAAAAGTCAGG + Intergenic
940041796 2:149369073-149369095 GCGGACCCAGAGGAGAAATAGGG + Intronic
940136815 2:150446451-150446473 GAAGACAGAGAGGAGAGGTACGG - Intergenic
941415648 2:165217641-165217663 GTTGACTGAGAGCAGAAGAGAGG + Intergenic
941669296 2:168274054-168274076 GTTGACTGAGAAGGGAAGGAAGG - Intergenic
946238481 2:218340044-218340066 GTTGTCCGAGAGGACAGGGATGG - Exonic
946355770 2:219183377-219183399 GATCACCCAGAGGAGCAGTAAGG - Exonic
946750399 2:222889640-222889662 AGTGACCTAGATGAGAAGTATGG + Intronic
948726610 2:239938138-239938160 GCTGTCCGAGAAGAGAAGTGGGG - Intronic
1172307135 20:33888883-33888905 GTTAACCCAGAGGAGAGGTGGGG - Intergenic
1176426389 21:6551107-6551129 GCTGACCTCGAGGAGAAGCAGGG + Intergenic
1177719783 21:24891118-24891140 GTTGAGAGAGAAGAGAAGTCCGG + Intergenic
1179436763 21:41367782-41367804 GTGGACCCAGAGGAGAGGTGAGG - Intronic
1179701880 21:43159424-43159446 GCTGACCTCGAGGAGAAGCAGGG + Exonic
1180021566 21:45131692-45131714 CTTGACTGAAAGGAGAAGTGAGG + Intronic
1183341993 22:37286633-37286655 GCTGGCAGAGAGGAGAAGGAAGG + Intronic
954095130 3:48320212-48320234 GGTTACAGAGAGCAGAAGTAGGG + Intronic
955688758 3:61569762-61569784 GTTGAGGGTGAGGAGGAGTAGGG + Intronic
961192583 3:124974415-124974437 GGTGACCCAGAGGACAAGTCAGG - Intronic
969476688 4:7426147-7426169 GTAGACCCAGAGGAGAAGGTGGG + Intronic
971701545 4:29984190-29984212 GTTTAAGGAGAGGAGAAGGAAGG + Intergenic
976780463 4:88752717-88752739 ATGGACTGAGAGGCGAAGTAAGG + Intronic
979422519 4:120522940-120522962 GTAGACAGAGAGTAGAAGGATGG + Intergenic
981499503 4:145434834-145434856 TTTGACCAAGAGTAGAAGTCTGG + Intergenic
986340895 5:6788437-6788459 GTTGACTGAGAGGACAGGGATGG + Intergenic
986830530 5:11572321-11572343 GTTGACCGAAACCTGAAGTATGG - Intronic
988510208 5:31858293-31858315 GGTGTCCCAGAGGAGAAGGAAGG - Intronic
990125763 5:52516101-52516123 GTAGACGGAGAGTAGAAGGATGG + Intergenic
990413053 5:55560215-55560237 GTTGACCGTGAGAACAATTAAGG - Intergenic
993754139 5:91706611-91706633 GTTAAACTAGAGGAGAAGAAAGG + Intergenic
993989970 5:94644055-94644077 GTTGACAGATGTGAGAAGTAAGG - Intronic
1000123246 5:158218377-158218399 ATTGACCGAGATGAGAAATTTGG - Intergenic
1007197572 6:40075886-40075908 GTTGCCAGAGAGTAGATGTATGG - Intergenic
1013467832 6:110433115-110433137 GGTGACCTAGAGGGGAAGTATGG + Intronic
1015415817 6:132947041-132947063 GTAGATTGAGAAGAGAAGTAAGG - Intergenic
1017295657 6:152790545-152790567 GGTGGCCATGAGGAGAAGTAAGG - Intergenic
1017800220 6:157888920-157888942 GTTGACTGTGAGGAGGAGTGTGG + Intronic
1023515425 7:40996805-40996827 GTTTACTGAGGGGAGAAGCAAGG + Intergenic
1024622127 7:51169664-51169686 ATTGACAGAGAGTAGAAGGATGG + Intronic
1033026700 7:137781477-137781499 GTTGAGAGAGAGGAGGAGGAAGG - Intronic
1040294961 8:46144371-46144393 GGTGGCAGAGAGGAGAAGTACGG - Intergenic
1040301251 8:46189130-46189152 GCAGACAGAGAGGAGAAGTGGGG + Intergenic
1049520114 8:143083498-143083520 GTGGACGGGGAGGAGAAGGAAGG - Intergenic
1050857832 9:10383989-10384011 GAAGACAGAGAGGAGAAGGATGG + Intronic
1052860446 9:33434890-33434912 CTGGACCGAGAGGCGAAGGACGG + Intergenic
1055010209 9:71557471-71557493 GTTGGCCCAGAGGAGAAGGGAGG + Intergenic
1056330541 9:85517495-85517517 GTTTACAGAAAGGGGAAGTATGG + Intergenic
1057026597 9:91738813-91738835 GCTGACCGGGAGGAGCAGGAGGG - Intronic
1059343607 9:113613442-113613464 GTTGACCATGAGGAGGAGGAAGG + Intergenic
1060222836 9:121773562-121773584 AATGACCGAGAGGAGGAGCATGG - Intronic
1060679792 9:125552043-125552065 AGTGTCAGAGAGGAGAAGTAGGG - Intronic
1187270352 X:17775118-17775140 AGTGGCCGAGAGGAGAAGGATGG - Intergenic
1188942926 X:36262395-36262417 GGTGACAGAGAGTAGAAGGATGG - Intronic
1189314150 X:40041916-40041938 GTGGAAGGAGAGGAGAAGGAAGG + Intergenic
1196634738 X:117989506-117989528 GCTGGAGGAGAGGAGAAGTAAGG + Intronic
1199871204 X:151900450-151900472 GATGACAGAGAGGAGAAGCTGGG + Intergenic