ID: 1120129538

View in Genome Browser
Species Human (GRCh38)
Location 14:80788741-80788763
Sequence CTCGGTCAACCCTACAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120129531_1120129538 -3 Left 1120129531 14:80788721-80788743 CCCCTTACCCTACTTCTCCTCTC 0: 1
1: 0
2: 5
3: 71
4: 748
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129529_1120129538 24 Left 1120129529 14:80788694-80788716 CCTTTAGAACAATATGATCCTCT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129535_1120129538 -10 Left 1120129535 14:80788728-80788750 CCCTACTTCTCCTCTCGGTCAAC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129528_1120129538 25 Left 1120129528 14:80788693-80788715 CCCTTTAGAACAATATGATCCTC 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129532_1120129538 -4 Left 1120129532 14:80788722-80788744 CCCTTACCCTACTTCTCCTCTCG 0: 1
1: 0
2: 0
3: 23
4: 285
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129530_1120129538 6 Left 1120129530 14:80788712-80788734 CCTCTCTTGCCCCTTACCCTACT 0: 1
1: 0
2: 4
3: 40
4: 392
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1120129533_1120129538 -5 Left 1120129533 14:80788723-80788745 CCTTACCCTACTTCTCCTCTCGG 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120129538 Original CRISPR CTCGGTCAACCCTACAATTT AGG Intronic
911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG + Intronic
912346320 1:108966407-108966429 CTCCGTCGACATTACAATTTTGG + Intergenic
1075657144 10:124169461-124169483 CTCCGACAACCCTCCAATTATGG - Intergenic
1077165641 11:1135770-1135792 GTCAGTCAACACTAAAATTTAGG + Intergenic
1083366742 11:62145832-62145854 CTGGGTCAACCCCACAAGGTGGG - Intronic
1084806105 11:71580066-71580088 GTCTGTCATCCCTGCAATTTGGG - Intronic
1085666536 11:78419289-78419311 CTCCCTTAACCTTACAATTTAGG + Intergenic
1086539772 11:87895035-87895057 CTCCATCAACCCTACAAAATGGG - Intergenic
1099888672 12:88562841-88562863 CCAGGTCAGCCCTTCAATTTTGG - Intronic
1101455482 12:104826412-104826434 CTAGGTCAATCCTACATTGTCGG - Intronic
1102863809 12:116358816-116358838 CTCGGTTAGCCCTGAAATTTGGG - Intergenic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1106647396 13:31651144-31651166 GTGGGTCACCCCTTCAATTTTGG + Intergenic
1110419742 13:75292893-75292915 ATCTGTAAACCCAACAATTTGGG + Intronic
1111468419 13:88646339-88646361 CTAGATCAATCCTACAATGTTGG - Intergenic
1117087988 14:52220927-52220949 CTCCATCAACCCCACAACTTTGG - Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1123042148 14:105494683-105494705 CTAGGTCAACCCTAACACTTGGG - Intronic
1134842942 16:17416063-17416085 CTCGGCCCTCCCGACAATTTGGG + Intronic
1155839854 18:30631222-30631244 CTGGATCAATCCTACAATGTTGG + Intergenic
932535664 2:72592268-72592290 CTCTGTCACCCCTCCAATATTGG - Intronic
941997894 2:171618421-171618443 CTCTGTCAACCCCACATTTGTGG + Intergenic
942403166 2:175624804-175624826 TTTTCTCAACCCTACAATTTGGG + Intergenic
1170804079 20:19614658-19614680 CTCTCCCAACGCTACAATTTGGG - Intronic
1176718838 21:10377366-10377388 CTCGGCCAACCCTTGAATTTAGG + Intergenic
1180300063 22:11030261-11030283 CTCGGCCAACCCTTGAATTTAGG + Intergenic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
950049528 3:9976475-9976497 TTTGGTCTACCCTACAGTTTTGG - Intronic
956494895 3:69814586-69814608 CTGGTTCATCCCAACAATTTGGG - Intronic
961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG + Intergenic
964787416 3:160413303-160413325 CTGGGTCAAGGCTAGAATTTAGG - Intronic
969656114 4:8499462-8499484 CTTCTTCAACCCTCCAATTTTGG + Intergenic
972892273 4:43573459-43573481 CTCGAGCAATCCTACAATGTTGG - Intergenic
972918159 4:43905330-43905352 CTGGATCAACCCTACATTGTCGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
980364270 4:131778766-131778788 CTAGGTCAACCTTACCCTTTGGG + Intergenic
986207025 5:5634493-5634515 CTGGGTCCACCTTATAATTTTGG + Intergenic
990980582 5:61599423-61599445 CTCAGACAAACTTACAATTTGGG + Intergenic
1016885518 6:148956173-148956195 CTCAGTCATCCCTACCATATAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1021197671 7:17690928-17690950 ATCTGTCAACCCTACAATCTTGG - Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023713153 7:43016036-43016058 CTCTGTCCACCCAACAAGTTTGG + Intergenic
1037672267 8:21025210-21025232 CTGGGTCTACCCTAAAATCTAGG - Intergenic
1043986579 8:86699748-86699770 CTTGGACAACCCTATAAATTTGG - Intronic
1046401106 8:113704287-113704309 CTAAGAAAACCCTACAATTTAGG - Intergenic
1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG + Intronic
1051535628 9:18154282-18154304 CTCGGTCAACCCATAAATTATGG - Intergenic
1053628625 9:39904657-39904679 CTAGGTCAACCTTACCCTTTGGG + Intergenic
1053777441 9:41561687-41561709 CTAGGTCAACCTTACCCTTTGGG - Intergenic
1054215262 9:62346045-62346067 CTAGGTCAACCTTACCCTTTGGG - Intergenic
1054380412 9:64485165-64485187 GTCTGTCAACCCAACACTTTGGG + Intergenic
1054672219 9:67809304-67809326 CTAGGTCAACCTTACCCTTTGGG + Intergenic
1055743137 9:79411632-79411654 CTCGGTGAACCCAAGAAGTTTGG - Intergenic
1185541742 X:907828-907850 CCCGGCCAACCCTTGAATTTAGG - Intergenic